Asplenium trichomanes
speciesAt a glance
Occurrence records283 428
Data sources11
Biological traits48
DNA specimens38
eDNA detections24
Sources11 archives
Databases and archives Asplenium trichomanes's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility283 428 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources48 traits
Chemical compositionLOTUS11 compounds
Occurrence & distributionGBIF283 428 records
Environmental DNA1 datasets · 7 countries24 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB · GoaT5.1 Gbp
01Narrative
Asplenium trichomanes, appelée Capillaire des murailles, Fausse capillaire, Capillaire rouge, Doradille capillaire, Doradille chevelue ou Doradille polytric, est une petite fougère de la famille des Aspleniaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology11
Leaf length10 mm
Leaf length max200 mm
Leaf length min50 mm
Leaf mass95.5 mg
Leaf size78.54 mm²
⚠ sources differ — AusTraits: 78.54 mm² · LEDA: 1 042 mm² · GIFT: 1 042 mm²
Leaf width6 mm
Plant height0.237 m
⚠ sources differ — GIFT: 0.237 m · AusTraits: 0.25 m · LEDA: 0.175 m · TRY: 0.203 m
Plant height generative0.175 m
Plant height max0.35 m
Plant height min0.02 m
Seed mass0.0 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dispersal typewind
Flowering endAug
Flowering startJun
Life formperennial or lithophyte
Life spanperennial
Lifespan years40 years
⚠ sources differ — TRY: 40 years · AusTraits: 27.5 years
Pollination modeabiotic
Pollination syndromeabiotic
⚠ sources differ — AusTraits: abiotic · GIFT: wind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation mean2 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeother
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: fern · TRY: F
Habitat GIFTforest, mountains
Leaf compoundnesscompound
Leaf formelliptic
Leaf shapeelliptical oblong
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)476 mg/g
⚠ sources differ — TRY: 476 mg/g · LEDA: 337 mg/g
Leaf n31.2 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)18.82 mm²/mg
⚠ sources differ — TRY: 18.82 mm²/mg · LEDA: 10.9 mm²/mg · GIFT: 10.9 mm²/mg
Other traits3
Diaspore typespore
Shoot length max25 cm
Shoot length min6 cm
03Chemical composition11 compounds
Compounds documented for Asplenium trichomanes across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Carotenoids (C40, β-β)4
Flavonols3
Carotenoids (C40, β-ε)3
Carotenoids (C40, ε-ε)1
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol | present | LOTUS | |
| 5-hydroxy-2-(4-hydroxyphenyl)-3-[(2S,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-7-[(2S,3S,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-3-[(2S,3S,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxychromen-4-one | present | LOTUS | |
| alpha-Carotene | present | LOTUS | |
| Cryptoxanthin | present | LOTUS | |
| Kaempferol-3,7-O-bis-alpha-L-rhamnoside | present | LOTUS | |
| Lutein | present | LOTUS | |
| Lutein 5,6-epoxide | present | LOTUS | |
| Mutatoxanthin | present | LOTUS | |
| Rhodoxanthin | present | LOTUS |
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asplenium trichomanes has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes6
GenBank sequences10
eDNA detections24
Countries9
The DNA barcodea real sequence read deposited for this species
AAGCTGGTGTCAAAGATTACCGGCTGACTTATTACACCCCCGAATACAAAGTTAAAGATACTGATATTTTGGCAGCTTTTCGGATGACCC …
Asplenium trichomanes voucher TAIF:Lu29851 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL10★rbcLa★trnL-F★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Asplenium trichomanes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 070 929 999 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Asplenium trichomanes5.07 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 144 n = 72
Ploidy2× diploid · measured
Chromosome records72–2162n range144median144mode57records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 14439×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Lovis, J.D. Species Studies in the British Flora : 99-103 (1955)
CCDB · brit-fl — Manton, I. Probl. Cytol. Evol. Pterid. (1950)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1502
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1503
CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.
CCDB · book-ipcn67-71 — KOUL, A.K. 1970. Supernumerary cell divisions following meiosis in the spider plant. Genetica 41: 305-310.
CCDB · book-LoveLove1977 — Manton 1950
CCDB · book-LoveLove1977 — Meyer 1952
CCDB · book-LoveLove1977 — Britton 1953
CCDB · book-LoveLove1977 — Manton 1953
CCDB · book-LoveLove1977 — Lovis 1955a
CCDB · book-LoveLove1977 — Lovis 1955b
CCDB · book-LoveLove1977 — Manton 1955
CCDB · book-LoveLove1977 — Mehra & Bir 1957
CCDB · book-LoveLove1977 — Meyer 1957
CCDB · book-LoveLove1977 — Meyer 1958a
CCDB · book-LoveLove1977 — Meyer 1958b
CCDB · book-LoveLove1977 — Bir 1959
CCDB · book-LoveLove1977 — Lovis 1959
CCDB · book-LoveLove1977 — Meyer 1959a
CCDB · book-LoveLove1977 — Fabbri (in Chiarugi 1960)
CCDB · book-LoveLove1977 — Meyer 1960a
CCDB · book-LoveLove1977 — Meyer 1960b
CCDB · book-LoveLove1977 — Wakefield 1961
CCDB · book-LoveLove1977 — Britton (in Fabbri 1963)
CCDB · book-LoveLove1977 — Lovis 1964a
CCDB · book-LoveLove1977 — Meyer 1964
CCDB · book-LoveLove1977 — Wagner & Chen (in Love & Solbrig 1964a)
CCDB · book-LoveLove1977 — Wagner & Wagner 1966
CCDB · book-LoveLove1977 — Bir & Shukla 1967
CCDB · book-LoveLove1977 — Bouharmont 1968
CCDB · book-LoveLove1977 — Taylor, R. L. & Mulligan 1968
CCDB · book-LoveLove1977 — Koul 1970
CCDB · book-LoveLove1977 — Bouharmont 1972b
CCDB · book-LoveLove1977 — Suinik & Lovka (in Love 1973)
CCDB · book-ipcn73-74 — SUSNIK, F., & M. LOVKA. 1973. In IOPB chromosome number reports XLI. Taxon 22: 459-464.
CCDB · Cave1963 — Meyer 1963
CCDB · CromoCat 2015 — Susnik, F. & M. Lovka. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLI]. Taxon 22(4): 462-463.
2n 7214×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — Lovis, J.D. Species Studies in the British Flora : 99-103 (1955)
CCDB · brit-fl — Emmott, J.I. New Phytol. 63: 306-318 (1964)
CCDB · brit-fl — Manton, I. Probl. Cytol. Evol. Pterid. (1950)
CCDB · iber-fl — Cytotaxonomy of spanish plants. I. Introduction. Pteridophyta and Gymnospermae. Lve, A. & E. Kjellqvist.Lagascalia2(1): 23-35(1972).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1504
CCDB · ipcn-api-dl — Hou, X. & Z. r. Wang. 2000. A subspecific taxonomic study on Asplenium trichomanes L. from China. Acta Phytotax. Sin. 38(3): 242–255.
CCDB · book-ipcn72 — LOEVE, A., & E. KJELLQVIST. 1972. Cytotaxonomy of Spanish plants. I. Introduction. Pteridophyta and Gymnospermae. Lagascalia 2: 23-35.
CCDB · book-LoveLove1977 — Lovis 1964b
CCDB · book-LoveLove1977 — Lovis, Melzer & Reichstein 1966
CCDB · eflora
CCDB · CromoCat 2015 — Tigerschiöld, E. (1981). The Asplenium trichomanes complex in East Central Sweden. Nord. J. Bot. 1: 12-16.
2n 1083×CCDB · brit-fl · CCDB · nw-europe-fl · CCDB · book-ipcn66
CCDB · brit-fl — Lovis, J.D. Species Studies in the British Flora : 99-103 (1955)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1501
CCDB · book-ipcn66 — Wagner & Wagner 1966
2n 731×CCDB · fl-europaea
CCDB · fl-europaea — Meyer, 1957
2n 2161×CCDB · new-zealand
CCDB · new-zealand
n 7212×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +6
CCDB · iber-fl — Two new Asplenium taxa from de Balearic Islands: A. azomanes and A. x tabulense (=A. azomanes x A. trichomanes subsp. quadrivalens). Rossell, J. A., P. Cubas & A. Rebassa.Rivasgodaya6: 115-128(1991).
CCDB · book-ipcn65 — Bir 1965
CCDB · ipcn-api-dl — Wang, Z. & Q. Xia. 1984. Cytological observations on some species of Dryopteris and Polystichum from China. Acta Bot. Sin. 26: 1–10.
CCDB · ipcn-api-dl — Tindale. 2002. In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia. Austral. Syst. Bot. 15: 839–937.
CCDB · book-ipcn67-71 — Q2 KURITA, s. 1967. Chromosome numbers of some Japanese Ferns (7). Ann. Rep. Foreign Students' Col. Chiba Univ. 2: 57-61.
CCDB · Cave1957 — Mehra & Bir
CCDB · Cave1962 — Bir 1962b
CCDB · Cave1963 — Fabbri 1963
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1964). Reports [In Löve, A. & O. T. Solbrig (eds.) IOPB chromosome numbers reports I]. Taxon 13(1): 99-110.
CCDB · CromoCat 2015 — Tindale (2002). In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia Austral. Syst. Bot. 15: 839–937
CCDB · iapt — IAPT/IOPB Chromosome Data 30
n 369×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1962 +3
CCDB · ipcn-api-dl — Bir, S. S. & G. S. Rai. 1984. SOCGI plant chromosome number reports -- II. J. Cytol. Genet. 19: 111–112.
CCDB · ipcn-api-dl — Khullar, S. P., S. S. Sharma & S. C. Verma. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Punetha, N. 1989. Cytological observations on ferns of Kumaon (N. W. Himalaya). Aspects Pl. Sci. 11: 459–465.
CCDB · ipcn-api-dl — Manton, I. 2002. In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia. Austral. Syst. Bot. 15: 839–937.
CCDB · book-ipcn67-71 — WAGNER, W.H . & F.S. WAGNER. 1969. A new natural hybrid in the Appalachian Asplenium complex and its taxonomic significance. Brittonia 21: 178-186.
CCDB · Cave1962 — Sorsa 1961
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1964). Reports [In Löve, A. & O. T. Solbrig (eds.) IOPB chromosome numbers reports I]. Taxon 13(1): 99-110.
CCDB · iapt — IAPT/IOPB Chromosome Data 30
n 811×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — KEMPF. C. 1967. Fougeres d'Alsace. Inf. Ann. Caryosyst. et Cytogenet. 1: 15-16.
n 1081×CCDB · Cave1956supp
CCDB · Cave1956supp — Brownlie 1954
n 1441×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bennert, H. W., R.E.G. Pichi Sermolli, H. Rasbach, K. Rasbach & T. Reichstein. (1989). Asplenium xhelii Lusina, the valid name for the hybrids between A. petrarchae (Guérin) Dc. and A. trichomanes L. (Aspleniaceae, Pteridophyta). II. Detailed description
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
08Occurrence & distribution
Record type283 428 records
Wild obs. + sensor269 967
Museum / vouchered12 127
Cultivated / captive20
Fossil2
Other1 312
Origin
Native21 403
Range
Area of Occupancy AOO334 828 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy46% within 1 km
≤100 m 70 001≤1 km 36 133≤10 km 124 239>10 km 2 592
232 965 georeferenced · 37 002 without coordinates
Open the mapobservation + sensor269 967
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 716≤1 km 1 903≤10 km 2 504>10 km 593
5 716 georeferenced · 6 411 without coordinates
Open the institutions mapphysical evidence12 127
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy27% within 1 km
≤1 km 3>10 km 8
11 georeferenced · 9 without coordinates
Open the mapnot free-living20
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions209 of 356 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 598 |
| Uniwersytet Wrocławskilocation not on record | 468 |
| Philadelphia, US | 382 |
| Beijing, CN | 347 |
| LDlocation not on record | 344 |
| Helsinki, FI | 333 |
| Provincia di Livornolocation not on record | 296 |
| Bergen, NO | 295 |
| Moscow State Universitylocation not on record | 242 |
| MeiseBGlocation not on record | 238 |
| Salzburg, AT | 237 |
| Xiamen, CN | 216 |
| Wellington, NZ | 213 |
| Christchurch, NZ | 179 |
| Barcelona, ES | 179 |
| Berlin, DE | 168 |
| MAlocation not on record | 161 |
| BDBClocation not on record | 160 |
| Chapel Hill, US | 157 |
| València, ES | 154 |
| Chongqing Museumlocation not on record | 148 |
| Olocation not on record | 147 |
| KMNlocation not on record | 141 |
| Nanjing, CN | 140 |
| Yangling, CN | 136 |
| Chengdu, CN | 136 |
| Chicago, US | 129 |
| Sanda, JP | 122 |
| Trondheim, NO | 119 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 115 |
| Adam Mickiewicz University in Poznańlocation not on record | 112 |
| Burlington, US | 101 |
| Bronx, US | 100 |
| Oskarshamn, SE | 93 |
| BFLlocation not on record | 86 |
| Minia, EG | 83 |
| Taipei, TW | 82 |
| Hobart, AU | 79 |
| Auckland, NZ | 77 |
| Museo Entomologico de Leonlocation not on record | 74 |
| Toyama, JP | 71 |
| BIO-UNIPIlocation not on record | 69 |
| Osaka, JP | 67 |
| South Kensington, GB | 63 |
| Ann Arbor, US | 62 |
| Wuhan, CN | 61 |
| Vancouver, CA | 60 |
| Tartu, EE | 59 |
| SLU Artdatabankenlocation not on record | 57 |
| Kuopio, FI | 57 |
| Kochi, JP | 55 |
| Wlocation not on record | 54 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 53 |
| Canberra, AU | 52 |
| Odawara, JP | 52 |
| Mount Annan, AU | 51 |
| Uppsala, SE | 50 |
| Oulu, FI | 49 |
| WTUlocation not on record | 48 |
| McWane Science Centerlocation not on record | 48 |
| New Haven, US | 47 |
| GZUlocation not on record | 46 |
| Victoria, CA | 46 |
| Zhejiang Universitylocation not on record | 46 |
| Xian, CN | 44 |
| CJBGlocation not on record | 42 |
| Institute of Plant and Animal Ecology Ural Branch of the Russian Academy of Scienceslocation not on record | 42 |
| Guangzhou, CN | 41 |
| San Sebastián, ES | 39 |
| Tampere, FI | 39 |
| University of New Hampshirelocation not on record | 39 |
| ISAlocation not on record | 39 |
| Nagano City, JP | 38 |
| Entomological Society of Latvialocation not on record | 38 |
| BClocation not on record | 36 |
| University of Silesia in Katowicelocation not on record | 36 |
| Philadelphia, US | 36 |
| EEZA-CSIClocation not on record | 36 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 35 |
| Salamanca, ES | 35 |
| University of Stellenboschlocation not on record | 35 |
| Yunnan Universitylocation not on record | 34 |
| Santiago de Compostela, ES | 31 |
| Sendai, JP | 31 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 30 |
| Dresden, DE | 30 |
| Allentown, US | 30 |
| Saint Louis, US | 29 |
| Shinshu Universitylocation not on record | 29 |
| Madrid, ES | 29 |
| Bangkok, TH | 28 |
| Adelaide, AU | 28 |
| Bloomington, US | 28 |
| Görlitz, DE | 27 |
| BRNUlocation not on record | 26 |
| PRClocation not on record | 25 |
| Zhengzhou, CN | 25 |
| Edinburgh, GB | 25 |
| College of the Atlantic, Museumlocation not on record | 25 |
| Pullman, US | 25 |
| Jyväskylä, FI | 24 |
| Université Lavallocation not on record | 23 |
| Bern, CH | 23 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 23 |
| GMBAlocation not on record | 22 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 22 |
| Turku, FI | 21 |
| Durham, US | 21 |
| College Park, US | 21 |
| Flagstaff, US | 20 |
| GJOlocation not on record | 20 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 20 |
| Taipei, TW | 20 |
| Frankfurt am Main | 19 |
| Jiangxi Universitylocation not on record | 19 |
| Hangzhou, CN | 18 |
| Appalachian State Universitylocation not on record | 18 |
| Urumqi, CN | 18 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 17 |
| Chengdu, CN | 17 |
| Shanghai, CN | 16 |
| Madison, US | 16 |
| Millersville, US | 16 |
| CICYTEXlocation not on record | 16 |
| Paris, FR | 16 |
| ASUlocation not on record | 15 |
| Tampa, US | 14 |
| Williamsburg, US | 14 |
| Portland, US | 14 |
| Morgantown, US | 14 |
| Anhui Normal Universitylocation not on record | 14 |
| Staten Island, US | 14 |
| Seoul, KR | 13 |
| Tacoma, US | 13 |
| Lausanne, CH | 13 |
| Granada, ES | 13 |
| Xinxiang, CN | 13 |
| Glarus, CH | 12 |
| Guiyang, CN | 12 |
| Wuhan, CN | 12 |
| Urumqi, CN | 12 |
| Western Carolina Universitylocation not on record | 12 |
| TAIElocation not on record | 12 |
| Zürich, CH | 11 |
| Denver, US | 11 |
| Institute of Biology Ufa Scientific Centre of Russian Academy of Scienceslocation not on record | 11 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 11 |
| Mlocation not on record | 11 |
| Albuquerque, US | 11 |
| Tokushima, JP | 10 |
| Shanghai, CN | 10 |
| Guilin, CN | 10 |
| Fort Worth, US | 10 |
| Garðabær, IS | 10 |
| US | 10 |
| Pamplona, ES | 10 |
| University of Tennessee at Chattanoogalocation not on record | 9 |
| Kensington, AU | 9 |
| Acadia Universitylocation not on record | 9 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 9 |
| Keene State Universitylocation not on record | 9 |
| KURAlocation not on record | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Brisbane, AU | 9 |
| Porvoo, FI | 9 |
| Knoxville, US | 9 |
| UIBlocation not on record | 9 |
| Parkville, AU | 9 |
| Corvallis, US | 9 |
| Sant Julià de Lòria, AD | 8 |
| Tromso University Museumlocation not on record | 8 |
| Forssa, FI | 8 |
| Tallinn, EE | 8 |
| SWlocation not on record | 8 |
| Porrentruy, CH | 8 |
| NMBU:MINAlocation not on record | 8 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 8 |
| Montréal, CA | 8 |
| Durham, US | 7 |
| Tilburg, NL | 7 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 7 |
| Moscow, US | 7 |
| Rotorua, NZ | 7 |
| Badajoz, ES | 7 |
| Beijing Normal Universitylocation not on record | 7 |
| Central China Normal Universitylocation not on record | 7 |
| Brookings, US | 7 |
| BSBIlocation not on record | 7 |
| CASlocation not on record | 6 |
| University of Calgarylocation not on record | 6 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 6 |
| Tomioka, JP | 6 |
| Québec, CA | 6 |
| GAlocation not on record | 6 |
| EL PASO, US | 6 |
| IFR-DNFlocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| QVMAGlocation not on record | 5 |
| Dekalb, US | 5 |
| Xining, CN | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Frauenfeld, CH | 5 |
| Córdoba, ES | 5 |
| Hudson, US | 5 |
| SZUlocation not on record | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| Columbia, US | 5 |
| TROMlocation not on record | 5 |
| Zhuzhou, CN | 4 |
| Sevilla, ES | 4 |
| Chicago, US | 4 |
| Toronto, CA | 4 |
| No collectionlocation not on record | 4 |
| Guiyang, CN | 4 |
| Bourges, FR | 4 |
| Herb. BBGlocation not on record | 4 |
| Johnson City, US | 4 |
| Armidale, AU | 4 |
| Pamplona, ES | 4 |
| Batemans Bay, AU | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Xiangtan City, CN | 4 |
| Mississippi State, US | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| Fairfax, US | 4 |
| Muzaffarabad, PK | 4 |
| H-AkrKGlocation not on record | 4 |
| Göteborg, SE | 3 |
| Montréal, CA | 3 |
| Trois-Rivières, CA | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| H-Wolflocation not on record | 3 |
| Durango, US | 3 |
| Alicante, ES | 3 |
| Asheville, US | 3 |
| Austin, US | 3 |
| Fujian Institute of Subtropical Botanylocation not on record | 3 |
| BAYLUlocation not on record | 3 |
| Banyoles, ES | 3 |
| Fulda, DE | 3 |
| Saint John, CA | 3 |
| Green Bay, US | 3 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 3 |
| Guiyang, CN | 3 |
| nbflocation not on record | 3 |
| Zürich, CH | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Jaén, ES | 3 |
| Riverside, US | 3 |
| Toyota city nature sanctuarylocation not on record | 3 |
| SCAUlocation not on record | 3 |
| Bando, JP | 3 |
| Phoenix, US | 3 |
| Cheney, US | 2 |
| UGentlocation not on record | 2 |
| Rovaniemi, FI | 2 |
| Awka, NG | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| South China Normal Universitylocation not on record | 2 |
| Cincinnati, US | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Stockholm, SE | 2 |
| Logan, US | 2 |
| UFRRJlocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Kew, GB | 2 |
| Chengdu, CN | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| H-Meierottlocation not on record | 2 |
| Fribourg, CH | 2 |
| Lubbock, US | 2 |
| Wuzhou, CN | 2 |
| Russellville, US | 2 |
| Podgorica, ME | 2 |
| Nijmegen, NL | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Bozeman, US | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| LfUlocation not on record | 2 |
| Provo, US | 2 |
| Vitoria, ES | 2 |
| USFSlocation not on record | 2 |
| Davenport, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Honolulu, US | 2 |
| Portland, US | 2 |
| Peking Universitylocation not on record | 2 |
| Smithfield, AU | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Sion, CH | 1 |
| PVTlocation not on record | 1 |
| Beijing, CN | 1 |
| Boumlocation not on record | 1 |
| Kingston, US | 1 |
| Fargo, US | 1 |
| Karlsruhe, DE | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 1 |
| Taipei, TW | 1 |
| Norfolk, US | 1 |
| Philadelphia, US | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Chiba, JP | 1 |
| Namur, BE | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Central China Agricultural Universitylocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| West China Subalpine Botanical Gardenlocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| FLADlocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| BMlocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| Anchorage, US | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| New Brunswick, US | 1 |
| Claremont, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Monastir, TN | 1 |
| USFS/BHSClocation not on record | 1 |
| GB | 1 |
| Ivano-Frankove, UA | 1 |
| Coimbra, PT | 1 |
| San Angelo, US | 1 |
| Mexico City, MX | 1 |
| Chelyabinsk State Universitylocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Salvador, BR | 1 |
| sxphclocation not on record | 1 |
| Elikins, US | 1 |
| Ashland, US | 1 |
| Walla Walla, US | 1 |
| Pittsburg, US | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Hamilton, US | 1 |
| University of Salzburglocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| Dehra Dun, IN | 1 |
| Whitehorse, CA | 1 |
| San Luis Obispo, US | 1 |
| Umeå Universitylocation not on record | 1 |
| 1 | |
| Palmerston North, NZ | 1 |
| TUR-Alocation not on record | 1 |
| SEINetlocation not on record | 1 |
| Miami, US | 1 |
| ENHMlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
356 institutions · 11 615 of 12 127 vouchered records shown · 499 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Asplenium trichomanes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map7 countries0
roadsideRocky ground and dolomite cliffs by Georgian…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.1 °C 7.10–18.6
Seasonal swing summer↔winter18.9 °C
Max temp (day)13.7 °C 8.50–22.3
Min temp (night)8.80 °C 2.30–16.1
Precipitation94.2 mm/mo 65.8–178
Air humidity62.6 % 58.8–67.3
Moisture balance6.10 mm/mo -37.2–125
Vapour deficit520 Pa 350–859
Wind speed3.50 m/s 2.00–5.30
Cloud cover48.8 % 39.2–64.8
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.