Asplenium serratum
speciesAt a glance
Occurrence records4 116
Data sources9
Biological traits21
DNA specimens3
eDNA detections3
Sources9 archives
Databases and archives Asplenium serratum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 116 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics3 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources21 traits
Occurrence & distributionGBIF4 116 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI3 specimens
Genome at a glanceCCDB2n = 144
01Narrative
Asplenium weberbaueri là một loài dương xỉ trong họ Aspleniaceae. Loài này được Hieron. mô tả khoa học đầu tiên năm 1918. Danh pháp khoa học của loài này chưa được làm sáng tỏ.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology2
Plant height max0.8 m
Plant height min0.2 m
Life cycle & reproduction3
Deciduousnessevergreen
Life formepiphyte or lithophyte
Life spanperennial
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteobligatory
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Epiphyte
Habitat GIFTBosque alto
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio31.29 g/g
Leaf c398 mg/g
Leaf dry-matter content (LDMC)208 mg/g
Leaf n21 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)24.29 mm²/mg
05DNA & barcoding3 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asplenium serratum has left across the world's sequence archives.
At a glance
DNA specimens3
Marker genes1
GenBank sequences4
eDNA detections3
Countries2
The DNA barcodea real sequence read deposited for this species
GGTGTTGGATTTAAAGCTGGTGTAAGAGATTATCGACTGACTTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTGGCAGCT …
Asplenium serratum voucher Daniel Tejero-Diez 5945 (MEXU, US) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL4
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Asplenium serratum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 144 n = 72
Chromosome records144–2882n range144median144mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1443×CCDB · ipcn-api-dl · CCDB · book-LoveLove1977 · CCDB · eflora
CCDB · ipcn-api-dl — Darnaedi, D. 1992. A preliminary cytological study of fern flora of Cede-Pangrango National Park (west Java). Pp. 73–78 <in> J.–l. Tsai & W.–c. Shieh (editors), Proceedings of the Second Seminar on Asian Pteridology Taiwan 17–22 March 1992. National Chung Hsing University and National Science Council.
CCDB · book-LoveLove1977 — Wagner 1963a
CCDB · eflora
2n 2881×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Guillén Villarroel, R. & J. R. Daviña. 2005. Estudios cromosómicos en especies de Asplenium (Aspleniaceae) de la Argentina. Darwiniana 43(1–4): 44–51.
08Occurrence & distribution
Record type4 116 records
Wild obs. + sensor267
Museum / vouchered3 848
Other1
Origin
Native483
Range
Area of Occupancy AOO8 416 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy44% within 1 km
≤100 m 68≤1 km 19≤10 km 29>10 km 80
196 georeferenced · 71 without coordinates
Open the mapobservation + sensor267
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 135≤1 km 23≤10 km 151>10 km 25
334 georeferenced · 3 514 without coordinates
Open the institutions mapphysical evidence3 848
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions85 of 200 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 502 |
| Bronx, US | 485 |
| University of Stellenboschlocation not on record | 239 |
| Chicago, US | 236 |
| Xiamen, CN | 110 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 108 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 87 |
| IECOSlocation not on record | 86 |
| JBRJlocation not on record | 81 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 81 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 80 |
| Museu Paraense Emílio Goeldilocation not on record | 69 |
| Kew, GB | 68 |
| Durango, MX | 64 |
| UFMGlocation not on record | 54 |
| Mexico City, MX | 51 |
| UFPRlocation not on record | 49 |
| Aarhus, DK | 47 |
| National Biodiversity Institute, Costa Ricalocation not on record | 44 |
| UFRRJlocation not on record | 37 |
| CEPLAClocation not on record | 33 |
| Viña del Mar, CL | 31 |
| Salvador, BR | 31 |
| Blumenau, BR | 29 |
| UFPElocation not on record | 26 |
| La Paz, BO | 25 |
| Universidad de Antioquia (UdeA)location not on record | 24 |
| Seropédica, BR | 23 |
| UFBAlocation not on record | 23 |
| St. Augustine, TT | 22 |
| Universidad Nacional de Colombia (UNAL)location not on record | 22 |
| Instituto de Ecología y Sistemáticalocation not on record | 22 |
| Zürich, CH | 22 |
| Calabar, NG | 22 |
| Austin, US | 21 |
| INMAlocation not on record | 19 |
| Santa Teresa, BR | 18 |
| Université de Bordeauxlocation not on record | 17 |
| Fort Worth, US | 17 |
| Universiti Sains Malaysialocation not on record | 16 |
| San Isidro, AR | 16 |
| UnBlocation not on record | 16 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 14 |
| San Francisco, US | 14 |
| Instituto do Meio Ambientelocation not on record | 13 |
| QCNElocation not on record | 13 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 13 |
| South Kensington, GB | 12 |
| Chaguaramas, TT | 12 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellín (JBM)location not on record | 12 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 11 |
| UNEMATlocation not on record | 11 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 11 |
| UNESP-IBILCElocation not on record | 11 |
| UFRPElocation not on record | 10 |
| Santarém, BR | 10 |
| Ann Arbor, US | 10 |
| LDlocation not on record | 10 |
| BIOECOlocation not on record | 10 |
| Philadelphia, US | 9 |
| Durham, US | 9 |
| León, NI | 9 |
| Porto Velho, BR | 9 |
| MAlocation not on record | 9 |
| Santa Cruz de la Sierra, BO | 9 |
| UNESP, Campus São José Rio Prêtolocation not on record | 8 |
| Cochabamba, BO | 8 |
| UNICAMPlocation not on record | 8 |
| Altos de Pipe, VE | 8 |
| Corrientes, AR | 8 |
| USP-IBlocation not on record | 8 |
| UFMSlocation not on record | 8 |
| Ivano-Frankivsk, UA | 8 |
| San José, CR | 8 |
| Universidad Nacional de Asunciónlocation not on record | 8 |
| Tampa, US | 8 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 7 |
| Laboratorio de Ictiologialocation not on record | 7 |
| Campo Mourão, BR | 7 |
| Stockholm, SE | 7 |
| Cuiabá, BR | 6 |
| HUT Culture Collectionlocation not on record | 6 |
| UEMAlocation not on record | 6 |
| St. Paul, US | 6 |
| Cascavel, BR | 6 |
| Minia, EG | 6 |
| Universidade do Estado de Mato Grossolocation not on record | 6 |
| Mérida, MX | 5 |
| Göteborg, SE | 5 |
| Madison, US | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| UTFPR-CPlocation not on record | 5 |
| WTUlocation not on record | 5 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 5 |
| MeiseBGlocation not on record | 5 |
| Pontifícia Universidade Católica do Paranálocation not on record | 4 |
| Guatemala City, GT | 4 |
| Provincia di Livornolocation not on record | 4 |
| UFESlocation not on record | 4 |
| Wellington, NZ | 4 |
| R.C.Moranlocation not on record | 4 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Cusco, PE | 4 |
| Ilhéus, BR | 4 |
| UNESP-RClocation not on record | 4 |
| Paleontological Collectionlocation not on record | 4 |
| Federal University of Espírito Santolocation not on record | 4 |
| Mexico City, MX | 4 |
| Pittsburg, US | 4 |
| Departamento de Sistematica e Ecologialocation not on record | 4 |
| UEMlocation not on record | 3 |
| Feira de Santana, BR | 3 |
| H.v.d.Werfflocation not on record | 3 |
| IAPlocation not on record | 3 |
| Iquitos, PE | 3 |
| Arequipa, PE | 3 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 3 |
| Berlin, DE | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| arosemena tola, EC | 3 |
| M. Floreslocation not on record | 3 |
| UFSClocation not on record | 3 |
| Tapachula, MX | 3 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Laboratory of Palaeontologylocation not on record | 2 |
| Cenargenlocation not on record | 2 |
| Chapel Hill, US | 2 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 2 |
| Montréal, CA | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Fortaleza, BR | 2 |
| Auckland, NZ | 2 |
| Burlington, US | 2 |
| Universidade da Região de Joinville - Univillelocation not on record | 2 |
| xUAMlocation not on record | 2 |
| US | 2 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 2 |
| VALElocation not on record | 2 |
| Universidad de Orientelocation not on record | 2 |
| Paris, FR | 2 |
| Bogotá, D.C., CO | 2 |
| UNISANTAlocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Anton de Kom University of Surinamelocation not on record | 2 |
| Salamanca, ES | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas SINCHIlocation not on record | 1 |
| Universidad del Valle (UniValle)location not on record | 1 |
| MEDELlocation not on record | 1 |
| University of Iowalocation not on record | 1 |
| University of Guyanalocation not on record | 1 |
| Wuzhou, CN | 1 |
| Facultad de Biología, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Chicago, US | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Plocation not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Jardim Botânico do Rio de Janeirolocation not on record | 1 |
| LGlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Lima, PE | 1 |
| UEPAlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Teresina, BR | 1 |
| BAYLUlocation not on record | 1 |
| COLlocation not on record | 1 |
| Bangkok, TH | 1 |
| Austin, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Turku, FI | 1 |
| BGBMlocation not on record | 1 |
| Brasília, BR | 1 |
| QAPlocation not on record | 1 |
| INBIOlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Sucre, BO | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Provo, US | 1 |
| Frankfurt am Main | 1 |
| FPMZBlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Londrina, BR | 1 |
| Uberlândia, BR | 1 |
| Chapingo, MX | 1 |
| P.J. Barbourlocation not on record | 1 |
| J.Mickellocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| Brasília, BR | 1 |
| Davis, US | 1 |
| UNIVASFlocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
200 institutions · 3 726 of 3 848 vouchered records shown · 121 without an institution code
09Environmental DNA3 detections
Where the DNA of Asplenium serratum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.7 °C 25.7–25.7
Seasonal swing summer↔winter2.30 °C
Max temp (day)30.0 °C
Min temp (night)22.3 °C
Precipitation201 mm/mo
Air humidity65.4 %
Moisture balance66.9 mm/mo
Vapour deficit1,144 Pa
Wind speed1.20 m/s
Cloud cover30.7 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.