Asplenium petrarchae

(Guérin) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Aspleniaceae/Asplenium

At a glance

Occurrence records3 922

Data sources7

Biological traits8

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Asplenium petrarchae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 922 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF3 922 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 144

01Narrative

Asplenium petrarchae ou la Doradille de Pétrarque est une espèce de petites fougères du genre Asplenium et de la famille des Aspleniaceae (Aspleniacées).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height0.055 m

Life cycle & reproduction3

Life formlithophyte

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asplenium petrarchae has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP899644.1 ↗1 234 bpSpain

ACGT

AAGATTACCGACTGACTTATTACACCCCCGAATACAAGGTTAAAGATACTGATATCTTGGCAGCTTTCCGGATGACCCCACAACCCGGAG …

Asplenium petrarchae subsp. petrarchae isolate 96 ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL7

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Asplenium petrarchae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 144 n = 72

Chromosome records144–1442n range144median144mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1444×CCDB · fl-europaea · CCDB · book-LoveLove1977

CCDB · fl-europaea — Manton, 1950

CCDB · book-LoveLove1977 — Manton 1950

CCDB · book-LoveLove1977 — Meyer 1963

CCDB · book-LoveLove1977 — Meyer 1964

n 723×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — ARRIGONI P.V. - 1976. Nuovi reperti di Asplenium petrarchae (Genrin) DC. in Italia.. Webbia , 30(2): 295-298.

CCDB · ipcn-api-dl — Arrigoni, P. V. 1976. Ad floram italicam notulae taxonomicae et geobotanicae.18. Nuovi reperti di Asplenium petrarchae (Guerin) DC. in Italia. Webbia 30: 295–298.

CCDB · ipcn-api-dl — Pérez Carro, F. J. & M. P. F. Areces. 1996. Híbridos del género Asplenium L. (Aspleniaceae) en la Península Ibérica. Anales Jard. Bot. Madrid 54: 106–125.

08Occurrence & distribution

Record type3 922 records

Wild obs. + sensor3 534

Museum / vouchered336

Other52

Origin

Native520

Range

Area of Occupancy AOO4 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 322≤1 km 637≤10 km 2 147>10 km 42

3 148 georeferenced · 386 without coordinates

Open the mapobservation + sensor3 534

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 7≤1 km 93≤10 km 105>10 km 1

206 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence336

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
València, ES	126
BDBClocation not on record	25
MAlocation not on record	19
Barcelona, ES	19
EEZA-CSIClocation not on record	15
Alicante, ES	12
LDlocation not on record	11
BClocation not on record	11
Vitoria, ES	8
Provincia di Livornolocation not on record	8
San Sebastián, ES	6
Granada, ES	6
UIBlocation not on record	5
Zürich, CH	4
College of the Atlantic, Museumlocation not on record	4
Zürich, CH	4
Xiamen, CN	4
Madrid, ES	3
JBSlocation not on record	3
Dresden, DE	3
CJBGlocation not on record	3
Córdoba, ES	3
Wlocation not on record	2
Uppsala, SE	2
Minia, EG	2
Sevilla, ES	2
CICYTEXlocation not on record	2
Chicago, US	2
Badajoz, ES	2
South Kensington, GB	2
Saint Louis, US	1
ISAlocation not on record	1
Bourges, FR	1
Salamanca, ES	1
Jaén, ES	1
Wellington, NZ	1
Adam Mickiewicz University in Poznańlocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Phyletisches Museum Jenalocation not on record	1
McWane Science Centerlocation not on record	1

40 institutions · 328 of 336 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Asplenium petrarchae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asplenium petrarchae

At a glance

Sources7 archives

Size & morphology1

Life cycle & reproduction3

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 922 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 922 records