Asplenium hookerianum

Colenso · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Aspleniaceae/Asplenium

At a glance

Occurrence records2 895

Data sources8

Biological traits20

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Asplenium hookerianum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 895 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF2 895 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 144

01Narrative

Asplenium hookerianum, yang umum dikenal sebagai pakis limpa Hooker, rocklax, dan pakis rambut gadis, adalah pakis kecil asli Selandia Baru dan Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Leaf length30 mm

Leaf length max220 mm

Leaf width9.5 mm

Plant height0.3 m

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typewind

Life spanperennial

Pollination syndromeabiotic

Resprouting capacityfire_killed

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formfern

Leaf compoundnesscompound

Leaf shapeelliptical narrowly_elliptical narrowly_ovate ovate widely_elliptical

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asplenium hookerianum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP774848.1 ↗1 248 bpAustralia · 2010

ACGT

GATTATCGACTTACTTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTGGCAGCTTTCCGGATGACCCCACAACCCGGAGTA …

Asplenium hookerianum voucher DJO203 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Asplenium hookerianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 144 n = 72

Chromosome records144–1442n range144median144mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1442×CCDB · new-zealand · CCDB · book-LoveLove1977

CCDB · new-zealand

CCDB · book-LoveLove1977 — Brownlie 1958

n 725×CCDB · barker-ferns · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2

CCDB · barker-ferns — Brownlie, G. "Chromosome numbers in New Zealand ferns."Transactions of the Royal Society of New Zealand. Vol. 85. The Society, 1958.

CCDB · ipcn-api-dl — Brownsey, P. J. & P. J. d. Lange. 1997. Asplenium cimmeriorum, a new species from New Zealand. New Zealand J. Bot. 35: 283–292.

CCDB · book-ipcn75-78 — Brownsey 1977

CCDB · Cave1956supp — Brownlie 1954

CCDB · Cave1958 — Brownlie 1958

08Occurrence & distribution

Record type2 895 records

Wild obs. + sensor1 550

Museum / vouchered1 345

Origin

Introduced1

Range

Area of Occupancy AOO6 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 972≤1 km 238≤10 km 47>10 km 31

1 288 georeferenced · 262 without coordinates

Open the mapobservation + sensor1 550

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 26≤1 km 22≤10 km 23>10 km 11

82 georeferenced · 1 263 without coordinates

Open the institutions mapphysical evidence1 345

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	594
Christchurch, NZ	396
Auckland, NZ	259
Rotorua, NZ	30
Hobart, AU	14
Museo Entomologico de Leonlocation not on record	14
Parkville, AU	5
South Kensington, GB	4
Xiamen, CN	4
St. Paul, US	3
University of Stellenboschlocation not on record	2
HAWlocation not on record	2
LDlocation not on record	2
Canberra, AU	2
Smithfield, AU	2
Palmerston North, NZ	2
Honolulu, US	2
Philadelphia, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
WTUlocation not on record	1
Provincia di Livornolocation not on record	1
Minia, EG	1
New Zealand Arthropod Collectionlocation not on record	1
Armidale, AU	1
Zürich, CH	1

25 institutions · 1 345 of 1 345 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Asplenium hookerianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asplenium hookerianum

At a glance

Sources8 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 895 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 895 records