Asplenium hemionitis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Aspleniaceae/Asplenium

At a glance

Occurrence records1 958

Data sources9

Biological traits16

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Asplenium hemionitis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 958 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF1 958 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT4.9 Gbp

01Narrative

Asplenium hemionitis is een varen uit de streepvarenfamilie (Aspleniaceae). De soort is endemisch in Macaronesië, de eilandengroep die de Canarische Eilanden, Madeira, de Azoren en de Kaapverdische Eilanden omvat.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Leaf length max180 mm

Leaf width max160 mm

Plant height max0.5 m

Plant height min0.1 m

Life cycle & reproduction5

Flowering endJun

Flowering startOct

Life formepiphyte

Life spanperennial

Raunkiær life formcryptophyte

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max600 m

Elevation min250 m

Growth formherb

Leaf formpalmatilobed

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asplenium hemionitis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP899633.1 ↗1 234 bpSpain

ACGT

AAGATTACCGACTGACTTATTACACCCCCGAATACAAAACTAAAGATACTGATATCTTGGCAGCTTTCCGGATGACCCCACAACCCGGAG …

Asplenium hemionitis isolate 206 ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Asplenium hemionitis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 850 880 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Asplenium hemionitis4.85 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidy2× diploid · measured

Chromosome records72–722n range72median72mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 722×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iber-fl — Hybrids in European Aspleniaceae (Pteridophyta). Reichstein, T.Ber. Schweiz. Bot. Ges.91: 104(1981).

n 362×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Queirós, M. & J. Ormonde. 1987. Contribuiçao para o conhecimento citotaxonómico da flora dos Açores III. Revista Biol. Univ. Aveiro 1: 31–46.

CCDB · ipcn-api-dl — Manton, I., J. D. Lovis, G. Vida & M. GIBBY. 1986. Cytology of the fern flora of Madeira. Bull. Brit. Mus. (Nat. Hist.), Bot. 15(2): 123–161.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type1 958 records

Wild obs. + sensor1 668

Museum / vouchered288

Other2

Origin

Native24

Range

Area of Occupancy AOO1 952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 305≤1 km 939≤10 km 190>10 km 82

1 516 georeferenced · 152 without coordinates

Open the mapobservation + sensor1 668

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 6≤1 km 30≤10 km 34>10 km 20

90 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence288

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	62
Olocation not on record	35
LDlocation not on record	22
Chicago, US	19
Zürich, CH	15
BClocation not on record	12
Paris, FR	11
Adam Mickiewicz University in Poznańlocation not on record	9
Xiamen, CN	9
Barcelona, ES	6
València, ES	6
Zürich, CH	6
Dresden, DE	5
Auckland, NZ	5
MAlocation not on record	5
Philadelphia, US	4
ISAlocation not on record	4
Edinburgh, GB	4
GJOlocation not on record	4
College of the Atlantic, Museumlocation not on record	3
Provincia di Livornolocation not on record	3
Wellington, NZ	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Sevilla, ES	2
Uppsala, SE	2
Madrid, ES	2
Minia, EG	2
Moscow State Universitylocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Entomological Society of Latvialocation not on record	1
St. Paul, US	1
STUlocation not on record	1
Salamanca, ES	1
WTUlocation not on record	1
Oskarshamn, SE	1
Association des Naturalistes de la Vallée du Loing et du Massif de Fontainebleaulocation not on record	1
CICYTEXlocation not on record	1
Bourges, FR	1
Vitoria, ES	1
Montréal, CA	1
Granada, ES	1
John May Museum of Natural Historylocation not on record	1
Millersville, US	1

43 institutions · 277 of 288 vouchered records shown · 11 without an institution code

09Environmental DNA2 detections

Where the DNA of Asplenium hemionitis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asplenium hemionitis

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction5

Habitat & environment7

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 958 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 958 records