Asplenium dareoides — The Life Data

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Aspleniaceae/Asplenium

At a glance

Occurrence records481

Data sources6

Biological traits10

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Asplenium dareoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility481 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF481 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Asplenium philippii là một loài dương xỉ trong họ Aspleniaceae. Loài này được Gand. mô tả khoa học đầu tiên năm 1913. Danh pháp khoa học của loài này chưa được làm sáng tỏ.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphytefacultative

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asplenium dareoides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLAY300112.1 ↗1 243 bp

ACGT

GACTGACTTATTACACCCCCGAATACAAGGTTAAAGATACTGATATCTTGGCAGCTTTCCGGATGACCCCACAACCCGGAGTACCAGCTG …

Asplenium dareoides ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type481 records

Wild obs. + sensor316

Museum / vouchered163

Cultivated / captive2

Origin

Native2

Range

Area of Occupancy AOO1 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 163≤1 km 66≤10 km 25>10 km 7

261 georeferenced · 55 without coordinates

Open the mapobservation + sensor316

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence163

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Valparaiso, CL	50
Nunoa, Santiago, CL	26
San Isidro, AR	21
Edinburgh, GB	11
Zürich, CH	6
MAlocation not on record	6
Viña del Mar, CL	4
Córdoba, AR	4
Saint Louis, US	4
Christchurch, NZ	4
Corrientes, AR	3
UChlocation not on record	3
Chicago, US	3
Kew, GB	2
Laboratory of Palaeontologylocation not on record	2
Bronx, US	2
Berlin, DE	1
AASlocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
Valparaíso, CL	1
University of Stellenboschlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Fundación Miguel Lillolocation not on record	1
Ciudad Autónoma de Buenos Aires, AR	1
Castelar, AR	1
Buenos Aires, AR	1
Trondheim, NO	1
Madrid, ES	1

28 institutions · 163 of 163 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Asplenium dareoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.