Asplenium auritum
Sw. · speciesAt a glance
Occurrence records3 441
Data sources8
Biological traits6
DNA specimens3
eDNA detections3
Sources8 archives
Databases and archives Asplenium auritum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 441 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics3 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements2 literature sources6 traits
Occurrence & distributionGBIF3 441 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI3 specimens
Genome at a glanceCCDB2n = 288
01Narrative
Asplenium bidentatum là một loài dương xỉ trong họ Aspleniaceae. Loài này được Willd. mô tả khoa học đầu tiên năm 1810. Danh pháp khoa học của loài này chưa được làm sáng tỏ.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTTRY
Size & morphology1
Plant height0.58 m
Life cycle & reproduction1
Deciduousnessevergreen
Habitat & environment2
Growth formepiphyte
Woodinessnon-woody
Physiology & chemistry2
Photosynthetic pathwayC3
Specific leaf area (SLA)18.18 mm²/mg
05DNA & barcoding3 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asplenium auritum has left across the world's sequence archives.
At a glance
DNA specimens3
Marker genes1
GenBank sequences9
eDNA detections3
Countries4
The DNA barcodea real sequence read deposited for this species
TTATTACACCCCCGAATACAAAACCAAAGATACCGATATCTTGGCTGCTTTCCGGATGACTCCACAACCCGGAGTACCAGCTGAAGAAGC …
Asplenium auritum var. rigidum voucher Rothfels 2616 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL9
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Asplenium auritum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 288 n = 144
Chromosome records288–2882n range288median288mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2882×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Walker, T. G. 1985. Some aspects of agamospermy in ferns--the Braithwaite system. In: A. F. Dyer & C. N. Page (editors), Biology of Pteridophytes. Proc. Roy. Soc. Edinburgh, Sect. B, Biol. Sci. 86: 59–66.
CCDB · ipcn-api-dl — Walker, T. G. 1985. Cytotaxonomic studies of the ferns of Trinidad 2. The cytology and taxonomic implications. Bull. Brit. Mus. (Nat. Hist.), Bot. 13(5): 149–249.
08Occurrence & distribution
Record type3 441 records
Wild obs. + sensor101
Museum / vouchered3 340
Origin
Native257
Range
Area of Occupancy AOO6 972 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 15≤1 km 5≤10 km 10>10 km 9
39 georeferenced · 62 without coordinates
Open the mapobservation + sensor101
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 99≤1 km 83≤10 km 308>10 km 34
524 georeferenced · 2 816 without coordinates
Open the institutions mapphysical evidence3 340
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions81 of 183 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 519 |
| Bronx, US | 358 |
| Universidad Nacional de Colombia (UNAL)location not on record | 172 |
| Xiamen, CN | 171 |
| Chicago, US | 154 |
| University of Stellenboschlocation not on record | 131 |
| National Biodiversity Institute, Costa Ricalocation not on record | 91 |
| UFMGlocation not on record | 85 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 76 |
| Aarhus, DK | 67 |
| Mexico City, MX | 61 |
| JBRJlocation not on record | 52 |
| Puerto Ayora, EC | 49 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 48 |
| UFRRJlocation not on record | 47 |
| Seropédica, BR | 46 |
| Universiti Sains Malaysialocation not on record | 40 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 37 |
| Universidad de Antioquia (UdeA)location not on record | 36 |
| San Isidro, AR | 36 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 36 |
| South Kensington, GB | 35 |
| Guatemala City, GT | 29 |
| UFPRlocation not on record | 25 |
| Durango, MX | 25 |
| La Paz, BO | 25 |
| BGBMlocation not on record | 24 |
| Durham, US | 22 |
| Viña del Mar, CL | 22 |
| Université de Bordeauxlocation not on record | 21 |
| HUT Culture Collectionlocation not on record | 20 |
| INMAlocation not on record | 19 |
| Santa Teresa, BR | 18 |
| QCNElocation not on record | 18 |
| León, NI | 18 |
| Kew, GB | 18 |
| UNESP, Campus São José Rio Prêtolocation not on record | 17 |
| Calabar, NG | 17 |
| UNESP-IBILCElocation not on record | 16 |
| Universidade Federal de Juiz de Foralocation not on record | 15 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellín (JBM)location not on record | 15 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 14 |
| UnBlocation not on record | 14 |
| Universidad de Caldas (UCaldas)location not on record | 14 |
| Tampa, US | 13 |
| Austin, US | 13 |
| LDlocation not on record | 11 |
| Cusco, PE | 11 |
| St. Paul, US | 11 |
| Corrientes, AR | 11 |
| Museu Paraense Emílio Goeldilocation not on record | 10 |
| Blumenau, BR | 10 |
| Stockholm, SE | 9 |
| Göteborg, SE | 9 |
| Pontifícia Universidade Católica do Paranálocation not on record | 9 |
| UFMSlocation not on record | 9 |
| Madison, US | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Zürich, CH | 8 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 7 |
| San Francisco, US | 7 |
| Santa Cruz de la Sierra, BO | 7 |
| Berlin, DE | 7 |
| Instituto de Ecología y Sistemáticalocation not on record | 7 |
| BIOECOlocation not on record | 7 |
| Ivano-Frankivsk, UA | 7 |
| Iquitos, PE | 6 |
| Cochabamba, BO | 6 |
| San José, CR | 6 |
| UFPElocation not on record | 6 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 6 |
| Provincia di Livornolocation not on record | 6 |
| Montréal, CA | 6 |
| UNEMATlocation not on record | 6 |
| Universidad de Orientelocation not on record | 6 |
| Salvador, BR | 6 |
| Paris, FR | 6 |
| CEPLAClocation not on record | 6 |
| UNESP-RClocation not on record | 6 |
| Universidad Nacional Federico Villarreallocation not on record | 5 |
| Davis, US | 5 |
| Tuxtla Gutiérrez, MX | 5 |
| WTUlocation not on record | 5 |
| Jena Microbial Resource Collectionlocation not on record | 5 |
| Lima, PE | 5 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 5 |
| UFOPlocation not on record | 5 |
| Arequipa, PE | 5 |
| Universidade do Estado de Mato Grossolocation not on record | 4 |
| PUC-RIOlocation not on record | 4 |
| UNICAMPlocation not on record | 4 |
| HUAlocation not on record | 4 |
| USP-IBlocation not on record | 4 |
| Laboratorio de Ictiologialocation not on record | 4 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| Miami, US | 4 |
| Fort Worth, US | 4 |
| Loja, EC | 3 |
| MCNAMlocation not on record | 3 |
| Wellington, NZ | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| UERJlocation not on record | 3 |
| MAlocation not on record | 3 |
| Universidad del Valle (UniValle)location not on record | 3 |
| OTSlocation not on record | 3 |
| H.v.d. Werfflocation not on record | 3 |
| Zürich, CH | 3 |
| Facultad de Biología, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Feira de Santana, BR | 3 |
| UFBAlocation not on record | 3 |
| Altos de Pipe, VE | 3 |
| ASUlocation not on record | 3 |
| Ann Arbor, US | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| UFRPElocation not on record | 2 |
| arosemena tola, EC | 2 |
| Instituto do Meio Ambientelocation not on record | 2 |
| Santarém, BR | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| Wuzhou, CN | 2 |
| Mexico City, MX | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Chaguaramas, TT | 2 |
| Córdoba, AR | 2 |
| COLlocation not on record | 2 |
| BMlocation not on record | 2 |
| IECOSlocation not on record | 2 |
| Puebla, MX | 2 |
| Antiguo Cuscatlán, SV | 2 |
| Mérida, MX | 2 |
| Quito, EC | 2 |
| UFESlocation not on record | 2 |
| IAPlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 2 |
| G.d. Neverslocation not on record | 1 |
| Austin, US | 1 |
| Provo, US | 1 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 1 |
| Zlocation not on record | 1 |
| Taipei, TW | 1 |
| xUAMlocation not on record | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| Instituto de Pesquisas Ambientaislocation not on record | 1 |
| Tapachula, MX | 1 |
| University of Iowalocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Auckland, NZ | 1 |
| Taipei, TW | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| Pretoria, ZA | 1 |
| Uppsala, SE | 1 |
| Brasília, BR | 1 |
| Dirección Nacional Forestal, Ministerio de Agricultura y Ganaderíalocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Dresden, DE | 1 |
| Turku, FI | 1 |
| Dublin, IE | 1 |
| UFAClocation not on record | 1 |
| Montecillo, Texcoco, MX | 1 |
| Edinburgh, GB | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| B.Ollgaardlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| MEXUlocation not on record | 1 |
| A.R. Smithlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| Podgorica, ME | 1 |
| Riobamba, EC | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Porto Velho, BR | 1 |
| Ciudad de México, MX | 1 |
| Cuiabá, BR | 1 |
| UTFPR-SLlocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
183 institutions · 3 272 of 3 340 vouchered records shown · 67 without an institution code
09Environmental DNA3 detections
Where the DNA of Asplenium auritum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.70 °C 8.70–8.70
Seasonal swing summer↔winter7.20 °C
Max temp (day)11.5 °C
Min temp (night)6.40 °C
Precipitation238 mm/mo
Air humidity53.3 %
Moisture balance119 mm/mo
Vapour deficit521 Pa
Wind speed3.60 m/s
Cloud cover26.2 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.