Aspidosperma subincanum

Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Aspidosperma

At a glance

Occurrence records727

Data sources7

Biological traits25

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Aspidosperma subincanum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility727 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS21 compounds

Occurrence & distributionGBIF727 records

DNA & barcodingNCBIsequences

01Narrative

Aspidosperma subincanum là một loài thực vật có hoa trong họ La bố ma. Loài này được Mart., sau đó là A.DC. mô tả khoa học đầu tiên năm 1844.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height18 m

Plant height max12 m

Life cycle & reproduction6

Deciduousnessdeciduous

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTCerrado (lato sensu), Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry6

Leaf n14.57 mg/g

Leaf p1 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)20.8 mm²/mg

Wood density820 mg/cm³

03Chemical composition21 compounds

Compounds documented for Aspidosperma subincanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Corynanthe type16

Carboline alkaloids $ Corynanthe type2

Carbazole alkaloids1

Carboline alkaloids1

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
(13R,14E)-14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
(16E)-16-ethylidene-2-methylidene-4,14-diazatetracyclo[12.2.2.03,11.05,10]octadeca-3(11),5,7,9-tetraen-1-ol	present	LOTUS
(1R,12S,16R)-16-ethyl-15-methyl-11-methylidene-9,15-diazatetracyclo[10.3.1.02,10.03,8]hexadeca-2(10),3,5,7-tetraene	present	LOTUS
(1R,12S,16R)-16-ethyl-15-methyl-9,15-diazatetracyclo[10.3.1.02,10.03,8]hexadeca-2(10),3,5,7-tetraen-11-one	present	LOTUS
(1R,13R,14R,15Z)-15-ethylidene-13-methyl-11-aza-1-azoniapentacyclo[12.2.2.01,13.04,12.05,10]octadeca-4(12),5,7,9-tetraen-14-ol	present	LOTUS
(1R,13S,14R,15Z)-15-ethylidene-13-methyl-11-aza-1-azoniapentacyclo[12.2.2.01,13.04,12.05,10]octadeca-4(12),5,7,9-tetraen-14-ol	present	LOTUS
(1R,16Z)-16-ethylidene-2-methylidene-4,14-diazatetracyclo[12.2.2.03,11.05,10]octadeca-3(11),5,7,9-tetraen-1-ol	present	LOTUS
(1S,12R,16S)-16-ethyl-15-methyl-11-methylidene-9,15-diazatetracyclo[10.3.1.02,10.03,8]hexadeca-2(10),3,5,7-tetraene	present	LOTUS
(1S,13R,14S,15E)-15-ethylidene-13-methyl-11-aza-1-azoniapentacyclo[12.2.2.01,13.04,12.05,10]octadeca-4(12),5,7,9-tetraen-14-ol	present	LOTUS
(1S,13R,14S,15E)-15-ethylidene-13-methyl-11-aza-1-azoniapentacyclo[12.2.2.01,13.04,12.05,10]octadeca-4(12),5,7,9-tetraene	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspidosperma subincanum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLMT304079.1 ↗546 bp

ACGT

GAGTACAAATTGACTTATTATACTCCTGAATACCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTT …

Aspidosperma subincanum isolate NE017 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type727 records

Wild obs. + sensor2

Museum / vouchered704

Other21

Origin

Native364

Range

Area of Occupancy AOO1 596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 704 records without

Open the institutions mapphysical evidence704

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 57 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université de Bordeauxlocation not on record	88
Cenargenlocation not on record	62
UnBlocation not on record	58
Brasília, BR	55
UNICAMPlocation not on record	55
Campo Grande, BR	32
Laboratorio de Ictiologialocation not on record	29
Brasília, BR	28
UFMSlocation not on record	27
Bronx, US	25
Kew, GB	24
UNESP-FCAlocation not on record	19
San Jose State University, Museum of Birds and Mammalslocation not on record	19
Bogotá, D.C., CO	13
Universidade Federal de Goiáslocation not on record	13
UFVJMlocation not on record	12
JBRJlocation not on record	11
Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record	8
Universidade do Estado de Mato Grossolocation not on record	7
Ivano-Frankivsk, UA	7
Universidade Federal do Ceara, Departamento de Biologialocation not on record	7
Teresina, BR	6
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	6
UFMGlocation not on record	6
Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record	6
Istituto Agrario Castelnuovolocation not on record	5
Chaguaramas, TT	5
University of Stellenboschlocation not on record	5
UNITINSlocation not on record	4
Fortaleza, BR	4
Ural Federal University "B. N. Yeltsin"location not on record	4
Blumenau, BR	4
Museu Paraense Emílio Goeldilocation not on record	3
UFRPElocation not on record	3
UNESP-ISlocation not on record	3
UFPRlocation not on record	3
Jataí / Setor Industrial, BR	3
UNESP-RClocation not on record	3
Uberlândia, BR	3
Museum of Zoologylocation not on record	2
IPA/SPlocation not on record	2
UTFPR-CPlocation not on record	2
Universidade Federal de Juiz de Foralocation not on record	2
UFBAlocation not on record	2
Salvador, BR	2
Campo Mourão, BR	2
MAlocation not on record	2
UNEMATlocation not on record	2
UFSCarlocation not on record	2
UFOPlocation not on record	2
Universidade Federal de Sergipe (UFS)location not on record	1
Universidade Federal do Oeste da Bahialocation not on record	1
UNIVASFlocation not on record	1
UEPAlocation not on record	1
UNESP-IBILCElocation not on record	1
Masindi, UG	1
Cuiabá, BR	1

57 institutions · 704 of 704 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)