Aspidosperma ramiflorum

Müll.Arg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Aspidosperma

At a glance

Occurrence records211

Data sources8

Biological traits22

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Aspidosperma ramiflorum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility211 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF211 records

DNA & barcodingNCBIsequences

01Narrative

Aspidosperma ramiflorum is a timber tree native to Brazil and Bolivia.Kew World Checklist of Selected Plant FamiliesWalderley, M.G.L., Shepherd, G.J., Melhem, T.S. & Giulietti, A.M. (eds.) (2005). Flora Fanerogâmica do Estado de São Paulo 4: 1-392. Instituto de Botânica, São Paulo.Morokawa, R. & al. (2013). Apocynaceae s. str. do Parque Nacional da Serra da Canastra, Minas Gerais, Brasil. Rodriguésia; Revista do Instituto de Biologia Vegetal, Jardim Botânico e Estaçao Biologica do Itatiaya 64: 179-199.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height25 m

⚠ sources differ — GIFT: 25 m · TRY: 0.156 m

Plant height max30 m

Life cycle & reproduction6

Deciduousnessdeciduous

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTCerrado (lato sensu), Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)16.51 mm²/mg

Wood density380 mg/cm³

03Chemical composition9 compounds

Compounds documented for Aspidosperma ramiflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Yohimbine-like alkaloids3

Carboline alkaloids $ Corynanthe type3

Corynanthe type3

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3Z,12bR)-3-ethylidene-9-methoxy-2-[[(1R)-2,3,4,9-tetrahydro-1H-pyrido[3,4-b]indol-1-yl]methyl]-2,4,6,7,12,12b-hexahydro-1H-indolo[2,3-a]quinolizine	present	LOTUS
(2S,3Z,12bS)-3-ethylidene-9-methoxy-2-[[(1R)-2,3,4,9-tetrahydro-1H-pyrido[3,4-b]indol-1-yl]methyl]-2,4,6,7,12,12b-hexahydro-1H-indolo[2,3-a]quinolizine	present	LOTUS
2-[(2R,3E,12bS)-3-ethylidene-9-methoxy-2,4,6,7,12,12b-hexahydro-1H-indolo[2,3-a]quinolizin-2-yl]ethanol	present	LOTUS
2-[(2R,3Z,12bS)-3-ethylidene-9-methoxy-2,4,6,7,12,12b-hexahydro-1H-indolo[2,3-a]quinolizin-2-yl]ethanol	present	LOTUS
Amberlite CG 400	present	LOTUS
beta-Yohimbine	present	LOTUS
methyl (1S,15R,18R,19R,20R)-18-hydroxy-1,3,11,12,14,15,16,17,18,19,20,21-dodecahydroyohimban-19-carboxylate	present	LOTUS
Nb-methylusambarensine	present	LOTUS
Ramiflorine A	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspidosperma ramiflorum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG833433.1 ↗587 bpBrazil · 2013

ACGT

AAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACCAAACCAAAGATA …

Aspidosperma ramiflorum isolate VCS35191-a ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type211 records

Wild obs. + sensor1

Museum / vouchered188

Other22

Origin

Native77

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	19
UNICAMPlocation not on record	17
Saint Louis, US	16
La Paz, BO	16
Bronx, US	13
Ivano-Frankivsk, UA	11
JBRJlocation not on record	9
San Jose State University, Museum of Birds and Mammalslocation not on record	9
Chicago, US	9
Istituto Agrario Castelnuovolocation not on record	6
ESALQlocation not on record	6
UFVJMlocation not on record	5
UNESP-RClocation not on record	4
Maringá, BR	4
UFMGlocation not on record	3
Cochabamba, BO	3
Museum of Zoologylocation not on record	3
UFRRJlocation not on record	3
USP-IBlocation not on record	3
Stockholm, SE	3
Universidad Autónoma de Madridlocation not on record	2
Santa Cruz de la Sierra, BO	2
UEMlocation not on record	2
UFSCarlocation not on record	2
Laboratorio de Ictiologialocation not on record	2
Sucre, BO	2
Universidade Federal de Juiz de Foralocation not on record	2
Chaguaramas, TT	1
University of Stellenboschlocation not on record	1
Universidade de São Paulolocation not on record	1
FUVATESlocation not on record	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
UTFPR-CPlocation not on record	1
UNESP-FCAlocation not on record	1
Campo Mourão, BR	1
IAPlocation not on record	1
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	1
UNIVILLElocation not on record	1

38 institutions · 187 of 188 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)