Aspicilia cuprea

Owe-Larss. & A.Nordin · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Pertusariales/Megasporaceae/Aspicilia

At a glance

Occurrence records78

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Aspicilia cuprea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility78 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF78 records

DNA & barcodingNCBIsequences

01Narrative

Aspicilia cuprea, the copper sunken disk lichen, is a large 1 – diameter copperish-tan to brown crustose areolate lichen that forms large patches of adjacent lichens on rock (saxicolous).Field Guide to California Lichens, Stephen Sharnoff, Yale University Press, 2014, It grows only from northern California to Baja California.Lichen Flora of the Greater Sonoran Desert Region. Vol 3, Nash, T.H., Ryan, B.D., Gries, C., Bugartz, F., (eds.) 2001, [1] It is common and characteristic of siliceous rock in interior valley and western mountains of California. One to many irregularly shaped black apothecia are sunken into the thallus. Lichen spot tests are K+ red, C−, P+ orange, and I−.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspicilia cuprea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU057902.1 ↗543 bpUSA · 2004

ACGT

CATTACCGAGATTAGGGTCTTCCGGGGCCCGATCCTCCTACCCTTTGTGTATATACCTCTGTTGCTTCGGCGGATCCGGGGGTCGCGGTG …

Aspicilia sp. Owe-Larsson 9112 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type78 records

Wild obs. + sensor9

Museum / vouchered69

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 2>10 km 1

4 georeferenced · 5 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1≤10 km 2

5 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	21
ASUlocation not on record	18
Bronx, US	15
San Diego, US	6
San Luis Obispo, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Durham, US	1
Chicago, US	1
Fort Hayslocation not on record	1
Madison, US	1
Santa Barbara, US	1

11 institutions · 69 of 69 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)