Asphodelus tenuifolius
Cav. · speciesAt a glance
Occurrence records3 225
Data sources13
Biological traits38
DNA specimens9
eDNA detections6
Sources13 archives
Databases and archives Asphodelus tenuifolius's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 225 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics9 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources38 traits
Chemical compositionLOTUS · NPASS19 compounds
Occurrence & distributionGBIF3 225 records
Environmental DNA1 datasets · 1 countries6 detections
DNA & barcodingBOLD · NCBI9 specimens
Genome at a glanceCCDB2n = 28
01Narrative
Asphodelus tenuifolius is a common weed of fields, particularly of wheat and chickpea fields. It grows in Egypt and in the Sinai peninsula. It's also native to the Mediterranean region, Asia and the Mascarene Islands. It is generally present from the Canary Islands, across the Mediterranean to the Middle East and Afghanistan. It has a fibrous root system. It is also known as wild onion or "jungli piyaz" in Pakistan. Asphodelus_tenuifolius_001.jpg|Natural stand Asphodelus_tenuifolius_003.jpg|Inflorescence
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology14
Fruit length max4 mm
Fruit length min3 mm
Fruit width max4 mm
Fruit width min3 mm
Leaf length max200 mm
Leaf length min70 mm
Leaf width max4 mm
Leaf width min1 mm
Plant height0.2 m
Plant height max0.5 m
Plant height min0.1 m
Seed mass1.61 mg
⚠ sources differ — TRY: 1.61 mg · GIFT: 2.0 mg
Seed mass max2.94 mg
Seed mass min1.38 mg
Life cycle & reproduction9
Dehiscencedehiscent
Flower colourpink
Flower length max7.5 mm
Flower length min5.5 mm
Flowering endApr
Flowering startFeb
Life formannual
Life spanannual
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max800 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourbrown
Fruit typecapsule
Growth formherb
Woodinessnon-woody
Physiology & chemistry2
Photosynthetic pathwayC3
Specific leaf area (SLA)11.32 mm²/mg
Other traits2
Inflorescenceraceme
Plant support typefree-standing
03Chemical composition19 compounds
Compounds documented for Asphodelus tenuifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Anthraquinones and anthrones8
Flavones4
Flavanones2
Simple coumarins1
Anthraquinones and anthrones $ Simple coumarins1
Documented compounds19 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Eriodictyol | present | NPASS | |
| (10S)-1,8,10-trihydroxy-6-methyl-10-[(3R,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-2-[(9R)-4,5,9-trihydroxy-2-(hydroxymethyl)-10-oxoanthracen-9-yl]anthracen-9-one | present | LOTUS | |
| (S)-2-(3,4-Dihydroxyphenyl)-2,3-dihydro-5,7-dihydroxy-6-methoxy-4H-1-benzopyran-4-one | present | NPASS | |
| 1,8-Dihydroxyanthraquinone | present | LOTUS | |
| 2-Hentriacontyl-5,7-dihydroxy-8-methylchromen-4-one | present | LOTUS | |
| 3-(2,4-Dihydroxyphenyl)-4,7-dihydroxy-2H-1-benzopyran-2-one | present | LOTUS | |
| 4,5-dihydroxy-2-methyl-1-[(10R)-1,8,10-trihydroxy-6-methyl-9-oxo-10-[(2R,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]anthracen-2-yl]anthracene-9,10-dione | present | LOTUS | |
| 4,5-dihydroxy-2-methyl-1-[(10R)-1,8,10-trihydroxy-6-methyl-9-oxo-10-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]anthracen-2-yl]anthracene-9,10-dione | present | LOTUS | |
| 4,5-dihydroxy-2-methyl-1-[(10S)-1,8,10-trihydroxy-6-methyl-9-oxo-10-[(2R,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]anthracen-2-yl]anthracene-9,10-dione | present | LOTUS | |
| 4,5-dihydroxy-2-methyl-1-[(10S)-1,8,10-trihydroxy-6-methyl-9-oxo-10-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]anthracen-2-yl]anthracene-9,10-dione | present | LOTUS |
05DNA & barcoding9 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asphodelus tenuifolius has left across the world's sequence archives.
At a glance
DNA specimens9
Marker genes5
GenBank sequences10
eDNA detections6
Countries2
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGTCGAGGGCACGCCTGCCTGGGCGTCACGCCTC …
Asphodelus tenuifolius voucher 822-8-2014b 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Asphodelus tenuifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records28–842n range28median28mode39records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2829×CCDB · iapt · CCDB · iber-fl · CCDB · ipcn-api-dl +5
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iber-fl — Asphodelus tenuifolius and A. fistulosus (Liliaceae) are morphologically, genetically and biologically different species. Ruz Rejn, C. & al.Pl. Syst. Evol.169: 1-12(1990).
CCDB · iber-fl — Asphodelus cirerae, a forgotten species of Asphodelus sect. Verinea (Liliaceae). Morphological, palynological, Karyological... Daz Lifante, Z.Fl. Mediterranea1: 87-109(1991).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 240-244. Ruz Rejn, M. & al.Lagascalia10(2): 247-252(1981).
CCDB · ipcn-api-dl — Badr, A. & M. A. Hamoud. 1985. The karyotypes of two species of Asphodelus L. Liliaceae and five species of Erodium L'Hèrit. Geraniaceae. Egypt. J. Bot. 28: 145–148.
CCDB · ipcn-api-dl — Podlech, D. 1986. Chromosomenstudien en Pflanzen des Saharo-Sindischen Trockengebietes. Mitt. Bot. Staatssamml. München 22: 5–20.
CCDB · ipcn-api-dl — Díaz Lifante, Z. 1991. Asphodelus cirerae, a forgotten species of Asphodelus sect. Verinea (Liliaceae). Morphological, palynological, karyological and ecogeographical characterization. Fl. Medit. 1: 87–109.
CCDB · ipcn-api-dl — Ruiz Rejon, C., G. Blanca, M. Cueto, R. Lozano & M. R. Rejon. 1990. Asphodelus tenuifolius and A. fistulosus (Liliaceae) are morphologically, genetically and biologically different species. Pl. Syst. Evol. 169: 1–12.
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Malallah, G. A., M. Masood & M. Al-Dosari. 2001. Chromosome numbers of the Kuwaiti flora, III. Willdenowia 31: 411–418.
CCDB · book-ipcn67-71 — BORGEN, L. 1969. Chromosome numbers of vascular plants from the Canary Islands, with special reference to the occurence of polyploidy. Nytt Magasin for Botanik 16: 18-121.
CCDB · book-ipcn73-74 — SUSNIK, F., & M. LOVKA. 1973. In IOPB chromosome number reports XLI. Taxon 22: 459-464.
CCDB · book-ipcn73-74 — SEN, S. 1973. Structural hybridity intra-and interspecific level in Liliales. Folia Biol. (Cracow) 21: 83-197.
CCDB · book-ipcn73-74 — SHARMA, V.K. & B.D. CHAURASIA. 1974. Kosyological studies in Asphodelus tenuifolius Cav. Broteria, Ser. Bot. 43(70): 35-37.
CCDB · book-indian_vol2 — Prosina, M. (Fedorov) ; Reese, G. 1957; Arora, C.M. 1960; Mehra, P.N. & Malik, C;P. 196lc ; Borgen, L. 1969 ; Gupta, P.K. & Srivastava, A.K. 1971 ; Sharma, V.K. & Chaurasia, B.D. 1974 ; Rejon, M.R. 1976
CCDB · book-fedorov — IIposHHa 1936
CCDB · book-fedorov — Reese 1957
CCDB · book-fedorov — Arora 1960 (I. 1965)
CCDB · CromoCat 2015 — Susnik, F. & M. Lovka. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLI]. Taxon 22(4): 462-463.
CCDB · CromoCat 2015 — Barros Neves, J. (1973). Contribution à la connaissance cytotaxonomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47: 157-212.
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1973). Cytotaxonomy of Spanish plants. II. Monocotyledons. Lagascalia 3(2): 147-182.
CCDB · CromoCat 2015 — Nilsson, Ö. & P. Lassen. (1971). Chromosome numbers of vascular plants from Austria, Mallorca and Yugoslavia. Bot. Not. 124(2): 270-276.
CCDB · CromoCat 2015 — Arora, C. M. (1960). New chromosome report. Bull. Bot. Surv. India 2: 305.
CCDB · CromoCat 2015 — Díaz Lifante, Z. (1991a). Asphodelus cirerae, a forgotten species of Asphodelus sect. Verinea (Liliaceae). Morphological, palynological, karyological and ecogeographical characterization. Fl. Medit. 1: 87-109.
CCDB · CromoCat 2015 — Ruiz Rejón, C., G. Blanca López, M. Cueto, R. Lozano & M. Ruíz Rejón. (1990). Asphodelus tenuifolius and A. fistulosus (Liliaceae) are morphologically, genetically and biologically different species. Pl. Syst. Evol. 169: 1-12.
CCDB · CromoCat 2015 — Sharma, A. K. & B. D. Chaurasia. (1974). Karyological studies in Asphodelus tenuifolius Cav. Broteria Cienc. Nat. 43: 35-37.
CCDB · CromoCat 2015 — Ruiz Rejón, M., L. Pascual, C. Ruíz Rejón & J. L. Oliver. (1981b). Números cromosómicos para la flora española, 240-244. Lagascalia 10(2): 247-252.
2n 306×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · book-fedorov +2
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · book-indian_vol2 — Sharma, A.K. & Bhattacharyya, B. 1957a, b
CCDB · book-fedorov — Sharma A. K., Bhattacharyya B. 1957
CCDB · book-fedorov — I. 1958)
CCDB · Cave1958 — Sharma & Bhatt. 1957
CCDB · CromoCat 2015 — Sharma, A. K. & N. K. Bhattacharyya. (1957). Cytology of Asphodelus tenuifolius Cav. Caryologia 10: 330-339.
2n 842×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — BORGEN, L. 1969. Chromosome numbers of vascular plants from the Canary Islands, with special reference to the occurence of polyploidy. Nytt Magasin for Botanik 16: 18-121.
CCDB · CromoCat 2015 — Borgen, L. (1969). Chromosome numbers of vascular plants from the Canary Islands, with special reference to the occurrence of polyploidy. Nytt Mag. Bot. 16: 81-121.
2n 521×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Al-Turki, T. A., S. A. Filfilan & S. F. Mehmood. 2000. A cytological study of flowering plants from Saudi Arabia. Willdenowia 30: 339–358.
2n 561×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Barros Neves, J. (1973). Contribution à la connaissance cytotaxonomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47: 157-212.
n 1423×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +5
CCDB · iber-fl — Asphodelus cirerae, a forgotten species of Asphodelus sect. Verinea (Liliaceae). Morphological, palynological, Karyological... Daz Lifante, Z.Fl. Mediterranea1: 87-109(1991).
CCDB · iber-fl — Estudios cariolgicos en especies espaolas del orden Liliales. III. Liliaceae. Ruz Rejn, M.Anales Inst. Bot. Cavanilles34(2): 733-759(1978).
CCDB · iber-fl — IOPB. Chromosome number reports. LII. Palomeque, T. & M. Ruz Rejn.Taxon25(2/3): 346(1976).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 240-244. Ruz Rejn, M. & al.Lagascalia10(2): 247-252(1981).
CCDB · ipcn-api-dl — Capineri, R., G. D'Amato & P. Marchi. 1978. Numeri cromosomici per la Flora Italiana. 534-583. Inform. Bot. Ital. 10: 421-465.
CCDB · ipcn-api-dl — Díaz Lifante, Z. 1991. Asphodelus cirerae, a forgotten species of Asphodelus sect. Verinea (Liliaceae). Morphological, palynological, karyological and ecogeographical characterization. Fl. Medit. 1: 87–109.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Malallah, G. A., M. Masood & M. Al-Dosari. 2001. Chromosome numbers of the Kuwaiti flora, III. Willdenowia 31: 411–418.
CCDB · book-ipcn72 — AMIN, A. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684:°
CCDB · book-ipcn67-71 — GUPTA, P.K., & A.K. SRIVASTAVA. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.
CCDB · book-ipcn75-78 — Koul et al. 1976b
CCDB · book-ipcn75-78 — Ruiz Rejon 1978
CCDB · book-ipcn75-78 — Ruiz Rejon 1976
CCDB · book-ipcn73-74 — SHARMA, V.K. & B.D. CHAURASIA. 1974. Kosyological studies in Asphodelus tenuifolius Cav. Broteria, Ser. Bot. 43(70): 35-37.
CCDB · Cave1957 — Reese
CCDB · CromoCat 2015 — Capineri, R., D'Amato, G. & Marchi, P. (1978b). Numeri cromosomici per la flora italiana: 534-583. Inf. Bot. Ital. 10: 421-465.
CCDB · CromoCat 2015 — Ruíz Rejón, M. (1976a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LII]. Taxon 25(2/3): 341-342.
CCDB · CromoCat 2015 — Ruíz Rejón, M. (1978). Estudios cariológicos en especies españolas del orden Liliales. III. Familia Liliaceae. Anales Inst. Bot. Cavanilles 34(2): 733-759.
CCDB · CromoCat 2015 — Díaz Lifante, Z. (1991a). Asphodelus cirerae, a forgotten species of Asphodelus sect. Verinea (Liliaceae). Morphological, palynological, karyological and ecogeographical characterization. Fl. Medit. 1: 87-109.
CCDB · CromoCat 2015 — Gupta, P. K. & Srivastava, A. K. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIII]. Taxon 20(4): 610.
CCDB · CromoCat 2015 — Ruiz Rejón, M., L. Pascual, C. Ruíz Rejón & J. L. Oliver. (1981b). Números cromosómicos para la flora española, 240-244. Lagascalia 10(2): 247-252.
n 153×CCDB · ipcn-api-dl · CCDB · Cave1958 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · Cave1958 — Sharma & Bhatt. 1957
CCDB · CromoCat 2015 — Sharma, A. K. & N. K. Bhattacharyya. (1957). Cytology of Asphodelus tenuifolius Cav. Caryologia 10: 330-339.
n 281×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Díaz Lifante, Z. (1991a). Asphodelus cirerae, a forgotten species of Asphodelus sect. Verinea (Liliaceae). Morphological, palynological, karyological and ecogeographical characterization. Fl. Medit. 1: 87-109.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 225 records
Wild obs. + sensor2 841
Museum / vouchered380
Other4
Origin
Native187
Range
Area of Occupancy AOO6 956 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 327≤1 km 359≤10 km 696>10 km 14
1 396 georeferenced · 1 445 without coordinates
Open the mapobservation + sensor2 841
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy68% within 1 km
≤100 m 14≤1 km 83≤10 km 40>10 km 5
142 georeferenced · 238 without coordinates
Open the institutions mapphysical evidence380
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions32 of 62 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BClocation not on record | 22 |
| Granada, ES | 20 |
| MAlocation not on record | 19 |
| Wlocation not on record | 19 |
| Phyletisches Museum Jenalocation not on record | 19 |
| Barcelona, ES | 18 |
| Edinburgh, GB | 17 |
| Kew, GB | 15 |
| LDlocation not on record | 14 |
| Chicago, US | 14 |
| València, ES | 13 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 11 |
| MeiseBGlocation not on record | 10 |
| Paris, FR | 9 |
| EEZA-CSIClocation not on record | 9 |
| Sevilla, ES | 7 |
| Saint Louis, US | 7 |
| Entomological Society of Latvialocation not on record | 6 |
| Badajoz, ES | 5 |
| Alicante, ES | 5 |
| Hazara Universitylocation not on record | 5 |
| Jaén, ES | 4 |
| CICYTEXlocation not on record | 4 |
| BRNUlocation not on record | 4 |
| Vitoria, ES | 4 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 4 |
| Bronx, US | 4 |
| Muzaffarabad, PK | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Uppsala, SE | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Berlin, DE | 2 |
| Frankfurt am Main | 2 |
| Madrid, ES | 2 |
| PRClocation not on record | 2 |
| Rishon Le Zion, IL | 2 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| Baroda, IN | 2 |
| Salamanca, ES | 2 |
| Moscow State Universitylocation not on record | 2 |
| Dresden, DE | 2 |
| Pamplona, ES | 2 |
| Olocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| WAGlocation not on record | 1 |
| Görlitz, DE | 1 |
| Namur, BE | 1 |
| Bloomington, US | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| GJOlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| University of Agriculture, Faisalabadlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| Bourges, FR | 1 |
| Minia, EG | 1 |
| Gijón, ES | 1 |
| GAlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Austin, US | 1 |
| Fort Worth, US | 1 |
62 institutions · 344 of 380 vouchered records shown · 36 without an institution code
09Environmental DNA6 detections
Where the DNA of Asphodelus tenuifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.6 °C 14.6–19.8
Seasonal swing summer↔winter21.1 °C
Max temp (day)19.4 °C 19.4–25.7
Min temp (night)8.20 °C 8.20–12.5
Precipitation29.5 mm/mo 16.2–29.5
Air humidity49.6 % 48.3–49.6
Moisture balance-54.1 mm/mo -105–-54.1
Vapour deficit839 Pa 839–1,237
Wind speed2.80 m/s 2.80–2.90
Cloud cover41.1 % 37.6–41.1
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.