Asphodelus ramosus
speciesAt a glance
Occurrence records20 428
Data sources11
Biological traits34
DNA specimens2
eDNA detections0
Sources11 archives
Databases and archives Asphodelus ramosus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility20 428 records↗
BOLD SystemsCentre for Biodiversity Genomics2 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources34 traits
Chemical compositionLOTUS17 compounds
Occurrence & distributionGBIF20 428 records
DNA & barcodingBOLD · NCBI2 specimens
Genome at a glanceCCDB2n = 28
01Narrative
L'asphodèle ramifié, parfois appelé aussi asphodèle rameux, asphodèle à petits fruits ou bâton-blanc ramifié, est une espèce de plantes herbacées vivaces de la famille des Liliacées, selon la classification classique, ou des Asphodélacées, selon la classification phylogénétique, du genre Asphodelus.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology10
Leaf length max1 000 mm
Leaf size1 809 mm²
Leaf width max40 mm
Leaf width min10 mm
Plant height0.604 m
Plant height max1.6 m
Plant height min0.5 m
Seed mass3.1 mg
⚠ sources differ — TRY: 3.1 mg · GIFT: 6.67 mg
Seed mass max13.47 mg
Seed mass min3.1 mg
Life cycle & reproduction9
Dispersal typeself
Flower colourwhite
Flower length max20 mm
Flower length min11 mm
Flowering endMay
Flowering startMar
Life formtuberous geophyte
Life spanperennial
Raunkiær life formcryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
Woodinessnon-woody
Physiology & chemistry2
Photosynthetic pathwayC3
Specific leaf area (SLA)10.89 mm²/mg
Other traits3
Inflorescenceraceme
Leaf arrangementrosette
Plant support typefree-standing
03Chemical composition17 compounds
Compounds documented for Asphodelus ramosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Anthraquinones and anthrones11
Flavones6
Documented compounds17 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (10R)-1,8,10-trihydroxy-6-methyl-2-[(9S)-4,5,9-trihydroxy-2-methyl-10-oxoanthracen-9-yl]-10-[(2R,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]anthracen-9-one | present | LOTUS | |
| (10S)-1,8,10-trihydroxy-6-methyl-10-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-2-[(9R)-4,5,9-trihydroxy-2-methyl-10-oxoanthracen-9-yl]anthracen-9-one | present | LOTUS | |
| (10S)-10-[(10R)-1,8-dihydroxy-6-methyl-9-oxo-10-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-10H-anthracen-2-yl]-1,8,10-trihydroxy-3-methylanthracen-9-one | present | LOTUS | |
| (10S)-10-[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]-1,8,10-trihydroxy-6-methyl-2-[(9R)-4,5,9-trihydroxy-2-methyl-10-oxoanthracen-9-yl]anthracen-9-one | present | LOTUS | |
| 1,8-dihydroxy-6-methyl-2-[(9R)-4,5,9-trihydroxy-2-methyl-10-oxoanthracen-9-yl]anthracene-9,10-dione | present | LOTUS | |
| 1-[(10R)-1,8-dihydroxy-6-methyl-9-oxo-10-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]-10H-anthracen-2-yl]-4,5-dihydroxy-2-methylanthracene-9,10-dione | present | LOTUS | |
| 1-[(10S)-1,8-dihydroxy-6-methyl-9-oxo-10-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]-10H-anthracen-2-yl]-4,5-dihydroxy-2-methylanthracene-9,10-dione | present | LOTUS | |
| 1-[(10S)-1,8-dihydroxy-6-methyl-9-oxo-10-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]-10H-anthracen-2-yl]-4,5-dihydroxy-2-methylanthracene-9,10-dione | present | LOTUS | |
| 1-[(10S)-1,8-dihydroxy-6-methyl-9-oxo-10-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]-10H-anthracen-2-yl]-4,5-dihydroxy-2-methylanthracene-9,10-dione | present | LOTUS | |
| 1-[(10S)-1,8-dihydroxy-6-methyl-9-oxo-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]-10H-anthracen-2-yl]-4,5-dihydroxy-2-methylanthracene-9,10-dione | present | LOTUS |
05DNA & barcoding2 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asphodelus ramosus has left across the world's sequence archives.
At a glance
DNA specimens2
Marker genes1
GenBank sequences1
Countries1
The DNA barcodea real sequence read deposited for this species
CCGGATAACTGCTGAAAGCATCTAAGTAGTAAGCCCACCCCAAGATGAGTGCTCTCCTATTCCGACTTCCCCAGAGCCTCCGGTAGCACA …
Asphodelus ramosus 23S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, 4.5S ribosomal RNA gene, and internal transcribed spacer 3, complete sequence; and 5S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★ITS1
fungal barcode
06Genome at a glanceCCDB
The complete instruction manual Asphodelus ramosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records28–842n range28median28mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2810×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +3
CCDB · iber-fl — Chromosome numbers of vascular plants from Austria, Mallorca and Yugoslavia. Nilsson, O. & P. Lassen.Bot. Not.124: 270-276(1971).
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 70. Ruz Rejn, M., J. L. Oliver Jimnez & M. F. Dosse Herranz.Lagascalia8(1): 117-118(1978).
CCDB · fl-europaea — LOve & Kjellqvist,
CCDB · ipcn-api-dl — Díaz Lifante, Z. 1996. A karyological study of Asphodelus L. (Asphodelaceae) from the western Mediterranean. Bot. J. Linn. Soc. 121: 285–344.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · book-fedorov — IIpoanHa 1936
CCDB · CromoCat 2015 — Ruiz Rejón, M., J. L. Oliver Jiménez & M. F. Dosse Herranz. (1978b). Números cromosómicos para la flora española, 70. Lagascalia 8(1): 117-118.
2n 565×CCDB · iber-fl · CCDB · fl-europaea · CCDB · book-fedorov +2
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 70. Ruz Rejn, M., J. L. Oliver Jimnez & M. F. Dosse Herranz.Lagascalia8(1): 117-118(1978).
CCDB · fl-europaea — Barros Neves, 1973
CCDB · book-fedorov — La Cour 1952 (D. 1955)
CCDB · book-atlas-flowering-plants — La Cour 1952
CCDB · CromoCat 2015 — Ruiz Rejón, M., J. L. Oliver Jiménez & M. F. Dosse Herranz. (1978b). Números cromosómicos para la flora española, 70. Lagascalia 8(1): 117-118.
2n 522×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-fedorov — Sato D. 1942
CCDB · book-atlas-flowering-plants — Sato 1942
2n 841×CCDB · fl-europaea
CCDB · fl-europaea — Barros Neves, 1973
n 146×CCDB · ita-fl · CCDB · iber-fl · CCDB · book-ipcn75-78 +1
CCDB · ita-fl — CAPINERI R., D'AMATO G., MARCHI P. - 1979 (1978). Numeri cromosomici per la flora italiana:534-583.. Inform. Bot. Ital. , 10(3): 421-465.
CCDB · iber-fl — Estudios cariolgicos en especies espaolas del orden Liliales. III. Liliaceae. Ruz Rejn, M.Anales Inst. Bot. Cavanilles34(2): 733-759(1978).
CCDB · iber-fl — IOPB. Chromosome number reports. LII. Palomeque, T. & M. Ruz Rejn.Taxon25(2/3): 346(1976).
CCDB · book-ipcn75-78 — Ruiz Rejon 1978
CCDB · book-ipcn75-78 — Ruiz Rejon 1976
CCDB · CromoCat 2015 — Ruiz Rejón, M., L. Pascual, C. Ruíz Rejón & J. L. Oliver. (1981b). Números cromosómicos para la flora española, 240-244. Lagascalia 10(2): 247-252.
n 282×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 240-244. Ruz Rejn, M. & al.Lagascalia10(2): 247-252(1981).
CCDB · CromoCat 2015 — Ruiz Rejón, M., L. Pascual, C. Ruíz Rejón & J. L. Oliver. (1981b). Números cromosómicos para la flora española, 240-244. Lagascalia 10(2): 247-252.
n 351×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ruiz Rejón, M., L. Pascual, C. Ruíz Rejón & J. L. Oliver. (1981b). Números cromosómicos para la flora española, 240-244. Lagascalia 10(2): 247-252.
n 421×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ruiz Rejón, M., L. Pascual, C. Ruíz Rejón & J. L. Oliver. (1981b). Números cromosómicos para la flora española, 240-244. Lagascalia 10(2): 247-252.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type20 428 records
Wild obs. + sensor20 060
Museum / vouchered339
Cultivated / captive2
Other27
Origin
Native18
Introduced2
Range
Area of Occupancy AOO28 752 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy55% within 1 km
≤100 m 4 464≤1 km 1 875≤10 km 4 827>10 km 328
11 494 georeferenced · 8 566 without coordinates
Open the mapobservation + sensor20 060
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 8≤1 km 86≤10 km 55>10 km 4
153 georeferenced · 186 without coordinates
Open the institutions mapphysical evidence339
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2
2 georeferenced
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions22 of 40 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| MAlocation not on record | 47 |
| CICYTEXlocation not on record | 42 |
| Rishon Le Zion, IL | 26 |
| Barcelona, ES | 22 |
| Córdoba, ES | 21 |
| ISAlocation not on record | 21 |
| Alicante, ES | 15 |
| College of the Atlantic, Museumlocation not on record | 14 |
| Badajoz, ES | 14 |
| LDlocation not on record | 12 |
| València, ES | 10 |
| Wlocation not on record | 9 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 9 |
| Pamplona, ES | 6 |
| BDBClocation not on record | 5 |
| BClocation not on record | 5 |
| Berlin, DE | 5 |
| Görlitz, DE | 4 |
| Salamanca, ES | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Jaén, ES | 3 |
| BRNUlocation not on record | 3 |
| Madrid, ES | 3 |
| Auckland, NZ | 3 |
| JBSlocation not on record | 3 |
| RJBJCIlocation not on record | 2 |
| Saint Louis, US | 2 |
| Pamplona, ES | 2 |
| Moscow State Universitylocation not on record | 1 |
| WAGlocation not on record | 1 |
| Firenze, IT | 1 |
| Paris, FR | 1 |
| Dresden, DE | 1 |
| Coimbra, PT | 1 |
| ESP003location not on record | 1 |
| Kew, GB | 1 |
| EEZA-CSIClocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Stockholm, SE | 1 |
| Oskarshamn, SE | 1 |
40 institutions · 328 of 339 vouchered records shown · 10 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.