Asphodelus aestivus

Brot. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Asphodelus

At a glance

Occurrence records1 473

Data sources11

Biological traits28

DNA specimens7

eDNA detections7

Sources11 archives

Databases and archives Asphodelus aestivus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 473 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF1 473 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 70

01Narrative

Asphodelus aestivus (лат.) — вид растений семейства Ксанторреевые (Xanthorrhoeaceae). Голое, голубовато-зелёное растение. Имеет клубневое корни[неизвестный термин]. Высота: 0,5-1,2 м. Листья заострённые, до 40 х 2 см, плоские, с гладким краем. Сочные листья ядовиты для овец, но в жаркие летние месяцы, когда листья становятся сухими, они теряют свою ядовитость. Цветок имеет шесть белых лепестков с бледно-коричневыми жилами, 10-15 х 2-4 мм эллиптические или продолговато-яйцевидные, тупые. Пыльники жёлтые 2-2,5 мм. Цветёт с января по апрель. Плоды почти шаровидные 5,5-7,5 мм обратнояйцевидные. Семена серые с белыми бутонами. Вид можно найти в Средиземноморье: Португалии, Гибралтаре, Испании, Франции, Италии, Греции, Турции и в Израиле. Он растёт на сухих лугах и на скалистом или песчаном грунте.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length max8 mm

Fruit length min5 mm

Fruit width max10 mm

Fruit width min6 mm

Plant height max1.5 m

Plant height min0.5 m

Seed mass9.36 mg

Seed mass max13.04 mg

Seed mass min7.9 mg

Life cycle & reproduction6

Dehiscencedehiscent

Dispersal typewind

Flowering startMar

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth form detailedherb

Mycorrhiza type0.00000849

Woodinessnon-woody

Physiology & chemistry3

Leaf n20.3 mg/g

Leaf p1.4 mg/g

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition10 compounds

Compounds documented for Asphodelus aestivus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Anthraquinones and anthrones8

Simple coumarins1

Anthraquinones and anthrones $ Simple coumarins1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(10S)-1,8,10-trihydroxy-6-methyl-10-[(3R,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-2-[(9R)-4,5,9-trihydroxy-2-(hydroxymethyl)-10-oxoanthracen-9-yl]anthracen-9-one	present	LOTUS
1,8-Dihydroxyanthraquinone	present	LOTUS
3-(2,4-Dihydroxyphenyl)-4,7-dihydroxy-2H-1-benzopyran-2-one	present	LOTUS
4,5-dihydroxy-2-methyl-1-[(10R)-1,8,10-trihydroxy-6-methyl-9-oxo-10-[(2R,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]anthracen-2-yl]anthracene-9,10-dione	present	LOTUS
4,5-dihydroxy-2-methyl-1-[(10R)-1,8,10-trihydroxy-6-methyl-9-oxo-10-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]anthracen-2-yl]anthracene-9,10-dione	present	LOTUS
4,5-dihydroxy-2-methyl-1-[(10S)-1,8,10-trihydroxy-6-methyl-9-oxo-10-[(2R,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]anthracen-2-yl]anthracene-9,10-dione	present	LOTUS
4,5-dihydroxy-2-methyl-1-[(10S)-1,8,10-trihydroxy-6-methyl-9-oxo-10-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]anthracen-2-yl]anthracene-9,10-dione	present	LOTUS
Aloe emodin	present	LOTUS
asphodelin A-4'-O-beta-glucoside	present	LOTUS
Chrysophanol	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asphodelus aestivus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences8

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF013360.1 ↗502 bp

ACGT

CCCCCGGCGCGATGGGCGCCAAGGAACACGACGGTCGGAGGGAGTGGGCGGGCCTCGATCCTTCGGGCAGCGCCCTCGACCTCCGCACCC …

Asphodelus aestivus isolate P378 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asphodelus aestivus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Ploidypolyploid inferred

Chromosome records28–702n range70median70mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 703×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 240-244. Ruz Rejn, M. & al.Lagascalia10(2): 247-252(1981).

CCDB · ipcn-api-dl — Ruiz Rejon, M., L. Pascual, C. R. Rejon & J. L. O. Jimenez. 1981. In Numeros cromosomicos para la flora Espanola. 240-244. Lagascalia 10: 247–252.

CCDB · CromoCat 2015 — Ruiz Rejón, M., L. Pascual, C. Ruíz Rejón & J. L. Oliver. (1981b). Números cromosómicos para la flora española, 240-244. Lagascalia 10(2): 247-252.

2n 281×CCDB · mediterranean

CCDB · mediterranean

2n 851×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Díaz Lifante, Z. (1996). A karyological study of Asphodelus L. (Asphodelaceae) from the western Mediterranean Bot. J. Linn. Soc. 121:285-344

n 143×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 240-244. Ruz Rejn, M. & al.Lagascalia10(2): 247-252(1981).

CCDB · ipcn-api-dl — Ruiz Rejon, M., L. Pascual, C. R. Rejon & J. L. O. Jimenez. 1981. In Numeros cromosomicos para la flora Espanola. 240-244. Lagascalia 10: 247–252.

CCDB · CromoCat 2015 — Ruiz Rejón, M., L. Pascual, C. Ruíz Rejón & J. L. Oliver. (1981b). Números cromosómicos para la flora española, 240-244. Lagascalia 10(2): 247-252.

n 431×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Díaz Lifante, Z. (1996). A karyological study of Asphodelus L. (Asphodelaceae) from the western Mediterranean Bot. J. Linn. Soc. 121:285-344

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 473 records

Wild obs. + sensor1 164

Museum / vouchered306

Cultivated / captive3

Origin

Native29

Range

Area of Occupancy AOO3 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 58≤1 km 332≤10 km 677>10 km 3

1 070 georeferenced · 94 without coordinates

Open the mapobservation + sensor1 164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 1≤1 km 77≤10 km 40>10 km 56

174 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence306

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	74
ISAlocation not on record	41
Badajoz, ES	29
CICYTEXlocation not on record	22
Jaén, ES	17
Madrid, ES	14
Córdoba, ES	13
Karlsruhe, DE	11
MAlocation not on record	11
College of the Atlantic, Museumlocation not on record	10
Salamanca, ES	9
Alicante, ES	6
LDlocation not on record	5
Barcelona, ES	5
Wlocation not on record	5
Stockholm, SE	3
Coimbra, PT	3
BClocation not on record	2
JBSlocation not on record	2
Granada, ES	2
València, ES	2
Entomological Society of Latvialocation not on record	2
Copenhagen, DK	2
Moscow State Universitylocation not on record	2
RJBJCIlocation not on record	2
Clocation not on record	1
Saint Louis, US	1
Natural History Museum Rotterdamlocation not on record	1
Berlin, DE	1
Hunan Geological Museumlocation not on record	1
Vitoria, ES	1
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	1
PRClocation not on record	1
Edinburgh, GB	1
ESP003location not on record	1
UIBlocation not on record	1

36 institutions · 305 of 306 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Asphodelus aestivus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 14.6–14.6

Seasonal swing summer↔winter21.1 °C

Max temp (day)19.4 °C

Min temp (night)8.20 °C

Precipitation29.5 mm/mo

Air humidity49.6 %

Moisture balance-54.1 mm/mo

Vapour deficit839 Pa

Wind speed2.80 m/s

Cloud cover41.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asphodelus aestivus

At a glance

Sources11 archives

Size & morphology9

Life cycle & reproduction6

Diet & foraging1

Habitat & environment8

Physiology & chemistry3

Other traits1

Compound class profile3 classes

Documented compounds10 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 473 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 473 records