Asperuginoides axillaris

(Boiss. & Hohen.) Rauschert · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Asperuginoides

At a glance

Occurrence records23

Data sources8

Biological traits16

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Asperuginoides axillaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Asperuginoides é um género botânico pertencente à família Brassicaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.7 m

Plant height min0.07 m

Life cycle & reproduction5

Flowering endMay

Flowering startApr

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Elevation max2 600 m

Elevation min1 200 m

Growth formherb

Habitat GIFTforest, mountains, shrubberies, stony places

Woodinessnon-woody

Other traits2

Plant support typefree-standing

Shoot orientationprostrate

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asperuginoides axillaris has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFM164516.1 ↗255 bpUzbekistan

ACGT

TCGATACCTGTCCAAAACAGAACGACCCGCGAACAAACGATCCTCACTAGCGGTGGGCCAGTTTCTTAATTGATCTTGTGCTCCCCGAAT …

Asperuginoides axillaris partial ITS1, specimen voucher WAG:0143231

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asperuginoides axillaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl · CCDB · brass

CCDB · ipcn-api-dl — Khosravi, A. R. & A. A. Maassoumi. 1998. Contribution to the cytotaxonomy of some Cruciferae from Iran. Iran. J. Bot. 7(2): 193–206.

CCDB · brass — Khosravi & Maassoumi

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.296 ↗

08Occurrence & distribution

Record type23 records

Wild obs. + sensor4

Museum / vouchered19

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	11
Wlocation not on record	4
Kew, GB	1
Edinburgh, GB	1

4 institutions · 17 of 19 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Asperuginoides axillaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 6.50–13.9

Seasonal swing summer↔winter33.8 °C

Max temp (day)15.3 °C 11.6–19.0

Min temp (night)5.00 °C 1.70–8.20

Precipitation15.7 mm/mo 10.3–21.1

Air humidity52.0 % 49.0–55.0

Moisture balance-88.7 mm/mo -107–-70.3

Vapour deficit916 Pa 698–1,135

Wind speed4.60 m/s 4.10–5.20

Cloud cover38.0 % 33.6–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)