Asperisporium caricae

(Speg.) Maubl. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Asperisporium

At a glance

Occurrence records62

Data sources9

Biological traits0

DNA specimens1

eDNA detections3

Sources9 archives

Databases and archives Asperisporium caricae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF62 records

Environmental DNA3 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Asperisporium caricae under a microscope, displaying conidiophores and conidium. Asperisporium caricae is an ascomycete fungus that is a plant pathogen, found in North and South America. It is responsible for the black spot disease on papaya trees. It affects generally leaves and fruits at any time. Sporodochia of Asperisporium caricae was growing under side of leaf, dark blackish brown to black, stroma well-developed, erumpent.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asperisporium caricae has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH014928.1 ↗308 bpBrazil

ACGT

TAAAAAGTAAATTTGAACAAAAAAACTTTCAACAACGGATCTCGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA …

Asperisporium caricae isolate AC29 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor6

Museum / vouchered56

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 2≤10 km 14>10 km 8

24 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	15
Bernard Price Institute for Palaeontological Researchlocation not on record	14
Catholic University of Pekinglocation not on record	8
Auckland, NZ	7
CABI Bioscience Genetic Resource Collectionlocation not on record	3
Museo Entomologico de Leonlocation not on record	1
Baton Rouge, US	1
FLASlocation not on record	1

8 institutions · 50 of 56 vouchered records shown · 6 without an institution code

09Environmental DNA3 detections

Where the DNA of Asperisporium caricae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)