Aspergillus viridinutans

Ducker & Thrower · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records6

Data sources11

Biological traits0

DNA specimens6

eDNA detections6

Sources11 archives

Databases and archives Aspergillus viridinutans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF6 records

Environmental DNA2 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Aspergillus viridinutans is a species of fungus in the genus Aspergillus. The species was first isolated in Frankston, Victoria, Australia and described in 1954.McLennan, E.I.; Ducker, S.C.; Thrower, L.B. 1954. New soil fungi from Australian heathland: Aspergillus, Penicillium, Spegazzinia. Australian Journal of Botany. 2(3):355-364 It is from the Fumigati section of Aspergillus. Several fungi from this section produce heat-resistant ascospores, and the isolates from this section are frequently obtained from locations where natural fires have previously occurred. A. viridinutans has been identified as the cause of chronic aspergillosis. The mycotoxin viriditoxin was first identified in A. viridinutans. A draft genome sequence of the strain derived from the original species description has been generated.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition6 compounds

Compounds documented for Aspergillus viridinutans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Simple cyclic polyketides3

Piperidine alkaloids2

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(2E,4E,6E,8R)-8-hydroxy-1-[(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]-6-methyldodeca-2,4,6-trien-1-one	present	LOTUS
(2E,4E,6E,8S)-1-[(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]-8-methoxy-6-methyldodeca-2,4,6-trien-1-one	present	LOTUS
(4R,5S)-5-acetyl-3,5-dimethoxy-2-methyl-4-[(2R)-2-methylbutanoyl]cyclopent-2-en-1-one	present	LOTUS
(6R)-6-hydroxy-3,5-dimethoxy-2,6-dimethyl-4-[(2R)-2-methylbutanoyl]cyclohexa-2,4-dien-1-one	present	LOTUS
(6S)-6-hydroxy-5-(2-hydroxyethylamino)-3-methoxy-2,6-dimethyl-4-[(2R)-2-methylbutanoyl]cyclohexa-2,4-dien-1-one	present	LOTUS
Pecilocin	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus viridinutans has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences10

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKM613143.1 ↗539 bpBrazil

ACGT

CCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCG …

Aspergillus viridinutans strain URM7033 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus viridinutans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈34 888 349 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus viridinutans0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness98.6% BUSCO

08Occurrence & distribution

Record type6 records

Museum / vouchered6

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence6

10Collections & institutions

Institution	Specimens
UAclocation not on record	1

1 institutions · 1 of 6 vouchered records shown · 3 without an institution code

09Environmental DNA6 detections

Where the DNA of Aspergillus viridinutans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter19.4 °C

Max temp (day)11.9 °C

Min temp (night)4.40 °C

Precipitation57.6 mm/mo

Air humidity62.3 %

Moisture balance-9.50 mm/mo

Vapour deficit471 Pa

Wind speed3.40 m/s

Cloud cover41.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)