Aspergillus varians

Wehmer · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources10

Biological traits0

DNA specimens2

eDNA detections12

Sources10 archives

Databases and archives Aspergillus varians's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS34 compounds

Environmental DNA4 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈30 Mbp

01Narrative

Aspergillus varians is a species of fungus in the genus Aspergillus. It is from the Nidulantes section. The species was first described in 1899.Wehmer 1899, Bot. Centralbl. 80: 460

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition34 compounds

Compounds documented for Aspergillus varians across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cycloartane triterpenoids7

Guaiane sesquiterpenoids4

Germacrane sesquiterpenoids4

Cadinane sesquiterpenoids3

Eudesmane sesquiterpenoids2

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
(1aR,4aS,7R,7aS,7bR)-7-methyl-4-methylidene-1a-propan-2-yl-3,4a,5,6,7a,7b-hexahydro-2H-azuleno[7,8-b]oxiren-7-ol	present	NPASS
(1aR,4R,4aS,7R,7aS,7bR)-4,7-dimethyl-1a-propan-2-yl-3,4a,5,6,7a,7b-hexahydro-2H-azuleno[7,8-b]oxirene-4,7-diol	present	NPASS
(1R,2R,4aS,5S,8aR)-4a-methyl-8-methylidene-2-propan-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol	present	NPASS
(1R,3aS,4R,8aR)-1,4-dimethyl-7-propan-2-yl-2,3,3a,5,6,8a-hexahydroazulene-1,4-diol	present	NPASS
(1R,4R,4aR,6S,8aS)-6-(2-hydroxypropan-2-yl)-4,8a-dimethyl-1,2,3,4,5,6,7,8-octahydronaphthalene-1,4a-diol	present	NPASS
(1S,3aR,8aR)-1-methyl-4-methylidene-7-propan-2-yl-2,3,3a,5,6,8a-hexahydro-1H-azulene	present	NPASS
(1S,3S,4R,5S,6R,8S,11S,12S,15R,16R)-15-[(E,2R)-6-hydroxy-6-methylhept-4-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecane-4,5,6-triol	present	NPASS
(1S,3S,4R,5S,6S,8S,11S,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecane-4,5,6-triol	present	NPASS
(1S,3S,4S,6S,8S,11S,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecane-4,6-diol	present	NPASS
(4R)-4-hydroxy-4,6-dihydrofuro[3,2-c]pyran-2-one	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus varians has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences9

eDNA detections12

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKT316730.1 ↗498 bpHungary

ACGT

CCTCCCACCCGTGCCTACTTAACACTGTTGCTTCGGCGGGGAGCCCCTAGGGGCGAGCCGCCGGGGACCACCGAACTTCATGCCTGAGAG …

Aspergillus varians isolate 747 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus varians carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈29 824 925 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus varians0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

09Environmental DNA12 detections

Where the DNA of Aspergillus varians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys4

Countries1

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.8–22.8

Seasonal swing summer↔winter10.9 °C

Max temp (day)27.6 °C

Min temp (night)18.4 °C

Precipitation384 mm/mo

Air humidity66.7 %

Moisture balance232 mm/mo

Vapour deficit924 Pa

Wind speed3.00 m/s

Cloud cover43.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)