Aspergillus unilateralis

Thrower · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records1

Data sources10

Biological traits0

DNA specimens3

eDNA detections829

Sources10 archives

Databases and archives Aspergillus unilateralis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI829 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS33 compounds

Occurrence & distributionGBIF1 records

Environmental DNA5 datasets · 1 countries829 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Aspergillus unilateralis is a species of fungus in the genus Aspergillus. It is from the Fumigati section. Several fungi from this section produce heat-resistant ascospores, and the isolates from this section are frequently obtained from locations where natural fires have previously occurred. The species was first described in 1954. It has been reported to produce aszonapyrones and mycophenolic acid.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition33 compounds

Compounds documented for Aspergillus unilateralis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols7

Cinnamic acids and derivatives5

Flavones4

Other polyketide meroterpenoids2

Simple coumarins2

Documented compounds33 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3aR,4S,5R,7aR)-2-amino-N-(7,8-dimethoxy-2-oxochromen-3-yl)-3a,4,5-trihydroxy-3,4,5,7a-tetrahydro-1-benzothiophene-2-carboxamide	present	LOTUS
(E)-2-Decenedioic acid	present	LOTUS
2-(3,4-dihydroxyphenyl)-5-hydroxy-6,7-dimethoxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
2-[5-(2-Carboxyethenyl)-2-hydroxy-3-methoxyphenyl]-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoic acid	present	LOTUS
2-Decene-1,10-dioic Acid	present	LOTUS
3,3'-(6,6'-Dihydroxy-5,5'-dimethoxy[1,1'-biphenyl]-3,3'-diyl)di(prop-2-enoic acid)	present	LOTUS
3-(4-Hydroxy-3-Methoxyphenyl)Prop-2-Enoic Acid	present	LOTUS
5-5'-Dehydrodiferulic acid	present	LOTUS
5-chloro-N-(7,8-dimethoxy-2-oxochromen-3-yl)-4a,8-dihydroxy-4,5,8,8a-tetrahydro-1,2-benzoxazine-3-carboxamide	present	LOTUS
6-Methylscutellarein	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus unilateralis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences7

eDNA detections829

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV627118.1 ↗263 bpAustralia · 2023

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATT …

Aspergillus unilateralis isolate OTU_125 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

10Collections & institutions

Institution	Specimens
DPIlocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA829 detections

Where the DNA of Aspergillus unilateralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found829

Studies independent surveys5

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 829 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature20.0 °C 8.00–40.0

pH6.00 3.90–8.80

Conductivity19.0 µS/cm 10.0–51,924

Organic carbon0.61 % 0.06–5.84

Water content6.45 % 0.363–40.3

Nitrate-N2.00 mg/kg 1.00–33.0

Phosphorus6.00 mg/kg 2.00–116

Clay2.95 % 0.93–60.6

Sand96.1 % 23.0–99.1

Depth0.1 m 0–0.2

SoilPodosolChromosolTenosolKurosolCalcarosolVertosol

209 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 14.6–22.6

Seasonal swing summer↔winter11.6 °C

Max temp (day)22.2 °C 18.0–30.5

Min temp (night)13.8 °C 10.7–16.1

Precipitation29.5 mm/mo 9.40–101

Air humidity54.9 % 51.5–56.9

Moisture balance-89.5 mm/mo -203–28.5

Vapour deficit918 Pa 724–1,327

Wind speed4.10 m/s 2.80–5.00

Cloud cover9.40 % 6.30–21.2

CHELSA 1981–2010, ~9 km grid, at location & month of 825 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)