Aspergillus unguis

(Émile-Weill & L.Gaudin) Thom & Raper · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records17

Data sources12

Biological traits0

DNA specimens20

eDNA detections24

Sources12 archives

Databases and archives Aspergillus unguis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

OBISOcean Biodiversity Information System4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS268 compounds

Occurrence & distributionGBIF · OBIS17 records

Environmental DNA6 datasets · 6 countries24 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceGoaT · NCBI≈26 Mbp

01Narrative

Aspergillus unguis is a species of fungus in the genus Aspergillus, and the asexual state (anamorph) of Emericella unguis. Aspergillus unguis is a filamentous soil-borne fungus found on decomposing plant matter and other moist substrates including with building materials and household dust. Aspergillus unguis occurs mainly in tropical and subtropical soils but has also been isolated from various marine and aquatic habitats. The species was first isolated in 1935 by Weill and L. Gaudin. Historically, A. unguis was assigned to the A. nidulans group, a common group of soil-borne fungi due to the resemblance of its ascospores and cleistothecia to those of Emericella nidulans. Aspergillus unguis is distinctive, however, in possessing spicular hyphae. A number of synonyms have been collapsed into this species, including Sterigmatocystis unguis, Aspergillus laokiashanensis and Aspergillus mellinus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition268 compounds

Compounds documented for Aspergillus unguis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cycloartane triterpenoids31

Depsidones30

Asperane sesterterpenoids15

Depsides12

Flavonols9

Documented compounds268 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Catechin 3-Gallate	present	NPASS
(+)-Erythrodiol	present	NPASS
(1R,3S,6S)-6-[(1E,3E,5E,7Z,9E,11E,13E,15E,17E)-18-[(1S,4S,6R)-4-hydroxy-2,2,6-trimethyl-7-oxabicyclo[4.1.0]heptan-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-1,5,5-trimethyl-7-oxabicyclo[4.1.0]heptan-3-ol	present	NPASS
(1S)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(1R,4S)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol	present	NPASS
(1S,2R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14aR,14bS)-1,2,4a,6a,6b,9,9,12a-octamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-hexadecahydropicene-2,10-diol	present	NPASS
(1S,2R,5S,7S,9S,10S,12R,13S,16S)-10-hydroxy-1,5,9,13-tetramethyl-16-propan-2-yl-6-oxapentacyclo[10.7.0.02,9.05,7.013,17]nonadec-17-en-8-one	present	LOTUS
(1S,2S,4aS,6aR,6aR,6bR,8aR,10S,12aR,14aR,14bS)-1,2,4a,6a,6b,9,9,12a-octamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-hexadecahydropicene-2,10-diol	present	NPASS
(1S,3R,6S,8R,11S,12S,15R,16R)-15-[(2R)-6-(hydroxymethyl)hept-6-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(1S,3R,6S,8R,11S,12S,15R,16R)-15-[(2S,3R)-3-hydroxy-6-methylhept-5-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(1S,3R,6S,8R,11S,12S,15R,16R)-15-[(E,2R)-6-methoxy-6-methylhept-4-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus unguis has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes4

GenBank sequences10

eDNA detections24

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMH855847.1 ↗494 bp

ACGT

ATCATTACCGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCTTGAATACTAAACACTGTTGCTTCGGCGGGGAGCCCCTTCCGGG …

Aspergillus unguis strain CBS 118.37 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus unguis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈26 060 700 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus unguis0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type17 records

Museum / vouchered16

Cultivated / captive1

Range

Area of Occupancy AOO40 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	2
Scientific Institute of Public Health, Brusselslocation not on record	1
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	1

3 institutions · 4 of 16 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA24 detections

Where the DNA of Aspergillus unguis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys6

Countries6

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map6 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature22.6 °C 16.3–26.3

Conductivity48,035 µS/cm 44,772–51,298

Salinity35.5 PSU 35.3–35.6

Dissolved oxygen7.71 mg/L

Turbidity0.726 NTU

Nitrate1.80 µmol/L

Depth15.2 m 0–85.0

Coastal waterPelagic

3 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 14.3–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)25.9 °C 16.4–31.9

Min temp (night)20.5 °C 11.9–23.6

Precipitation112 mm/mo 45.0–137

Air humidity61.0 % 58.6–63.3

Moisture balance-8.90 mm/mo

Vapour deficit1,037 Pa 659–1,523

Wind speed2.90 m/s

Cloud cover36.1 % 26.0–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)