Aspergillus tonophilus — The Life Data

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources7

Biological traits0

DNA specimens0

eDNA detections3

Sources7 archives

Databases and archives Aspergillus tonophilus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Environmental DNA2 datasets · 0 countries3 detections

DNA & barcodingNCBIsequences

01Narrative

Aspergillus tonophilus is a species of fungus in the genus Aspergillus. It is from the Aspergillus section. The species was first described in 1962.Ohtsuki, T. 1962. Studies on the glass mould: On two species of Aspergillus isolated from glass. Botanical Magazine Tokyo. 75:436-442 It has been reported to produce auroglaucin, bisanthrons, dihydroauroglaucin, echinulins, flavoglaucin, an apolar indoloterpene, isoechinulins, neoechinulins, and tetrahydroauroglaucin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus tonophilus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections3

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMN332048.1 ↗261 bp

ACGT

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTC …

Aspergillus tonophilus isolate Unkown small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

09Environmental DNA3 detections

Where the DNA of Aspergillus tonophilus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.