Aspergillus terreus

Thom · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records326

Data sources13

Biological traits0

DNA specimens224

eDNA detections887

Sources13 archives

Databases and archives Aspergillus terreus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility303 records↗

OBISOcean Biodiversity Information System23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI887 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics224 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS475 compounds

Occurrence & distributionGBIF · OBIS326 records

Environmental DNA9 datasets · 17 countries887 detections

DNA & barcodingBOLD · NCBI224 specimens

Genome at a glanceGoaT · NCBI32 Mbp

01Narrative

Aspergillus terreus, also known as Aspergillus terrestris, is a fungus (mold) found worldwide in soil. Although thought to be strictly asexual until recently, A. terreus is now known to be capable of sexual reproduction. This saprotrophic fungus is prevalent in warmer climates such as tropical and subtropical regions. Aside from being located in soil, A. terreus has also been found in habitats such as decomposing vegetation and dust. A. terreus is commonly used in industry to produce important organic acids, such as itaconic acid and cis-aconitic acid, as well as enzymes, like xylanase. It was also the initial source for the drug mevinolin (lovastatin), a drug for lowering serum cholesterol. Aspergillus terreus can cause opportunistic infection in people with deficient immune systems. It is relatively resistant to amphotericin B, a common antifungal drug. Aspergillus terreus also produces aspterric acid and 6-hydroxymellein, inhibitors of pollen development in Arabidopsis thaliana.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition475 compounds

Compounds documented for Aspergillus terreus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pulvinones59

Tetraketide meroterpenoids52

Neolignans51

Quadrane sesquiterpenoids29

Carbazole alkaloids15

Documented compounds475 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-5(6)-dihydro-6-hydroxyterrecyclic acid A	present	LOTUS
(+)-5(6)-dihydro-6-methoxyterrecyclic acid A	present	LOTUS
(+)-Asperteretal G	present	LOTUS
(+)-Asperteretal H	present	LOTUS
(+)-asperteretone A	present	LOTUS
(+)-asperteretone B	present	LOTUS
(+)-asperteretone C	present	LOTUS
(+)-asperteretone F	present	LOTUS
(+)-Geodin	present	LOTUS
(+/-)-Terreic acid	present	LOTUS

05DNA & barcoding224 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus terreus has left across the world's sequence archives.

At a glance

DNA specimens224

Marker genes5

GenBank sequences10

eDNA detections887

Countries17

The DNA barcodea real sequence read deposited for this species

ITSPZ406393.1 ↗478 bpIndia · 2022

ACGT

TCTTTATGGCCACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCGCCGGGGGGCGACTCGCCC …

Aspergillus terreus isolate SR1207V17 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus terreus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size32 165 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus terreus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness99% BUSCO

07Deep time~30.6 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin30.6 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type326 records

Wild obs. + sensor73

Museum / vouchered229

Cultivated / captive21

Other3

Range

Area of Occupancy AOO508 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal7

median 5 352.5 m · max 5 400 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 57≤1 km 1≤10 km 3

61 georeferenced · 12 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 7≤1 km 2≤10 km 1>10 km 24

34 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence229

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 20 without coordinates

Open the mapnot free-living21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
PHlocation not on record	21
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	18
Gujarat Biodiversity Gene Banklocation not on record	10
Sydney Medical Schoollocation not on record	8
TNMlocation not on record	6
UFPElocation not on record	3
Bernard Price Institute for Palaeontological Researchlocation not on record	2
DPIlocation not on record	2
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	2
Scientific Institute of Public Health, Brusselslocation not on record	2
Queen Elizabeth II Medical Centrelocation not on record	1
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	1
ARMS-MBONlocation not on record	1
National Institute of Biological Resourceslocation not on record	1
UAclocation not on record	1
Lincoln, US	1

16 institutions · 80 of 229 vouchered records shown · 116 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA887 detections

Where the DNA of Aspergillus terreus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found887

Studies independent surveys9

Countries17

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 887 detections have coordinates

Open the map17 countries0

Underwater Biotechnology Park; semi-industri…Cr(VI) contaminated soilPalearcticNeotropicAfrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.55 4.74–8.87

Conductivity17,500 µS/cm 11.0–164,500

Organic carbon2.44 % 1.03–3.84

Nitrate-N2.00 mg/kg

Clay12.6 % 12.3–12.8

Sand80.9 % 78.3–83.6

Depth0 m

SoilRudosolKandosolTenosolsSodosolFerrosolVertosol

217 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 20.5–25.2

Seasonal swing summer↔winter11.3 °C

Max temp (day)29.0 °C 26.8–31.2

Min temp (night)17.5 °C 14.6–20.2

Precipitation8.60 mm/mo 4.10–56.7

Air humidity46.0 % 43.9–56.8

Moisture balance-127 mm/mo -137–-93.7

Vapour deficit1,514 Pa 1,223–1,610

Wind speed3.60 m/s 2.50–4.40

Cloud cover23.2 % 17.8–30.4

CHELSA 1981–2010, ~9 km grid, at location & month of 814 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)