Aspergillus tamarii

Kita · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records59

Data sources13

Biological traits0

DNA specimens4

eDNA detections45

Sources13 archives

Databases and archives Aspergillus tamarii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility55 records↗

OBISOcean Biodiversity Information System4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS16 compounds

Occurrence & distributionGBIF · OBIS59 records

Environmental DNA6 datasets · 11 countries45 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT · NCBI≈39 Mbp

01Narrative

Aspergillus tamarii is a species of fungus in the genus Aspergillus. It is from the Flavi section. The species was first described in 1913.Kita, G. 1913, Centralbl. Bakteriol., Abt. 2 37: 433 A. tamarii has been used in the production of soy sauce.Jong SC, Birmingham JM (1992). Current status of fungal culture collections and their role in biotechnology. In: Handbook of applied mycology, vol. 4:. Fungal biotechnology (Arora DK, Elander RP, Murekji KG, eds) New York: Marcel Dekker: 993–1024. It has been isolated from soil in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition16 compounds

Compounds documented for Aspergillus tamarii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclopiazonic acid-tpye tetramate alkaloids4

Ergot alkaloids3

Flavonols2

Carbazole alkaloids1

Lactones1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,3S,5Z,9R)-5-(1-hydroxyethylidene)-8,8,16-trimethyl-7,16-diazapentacyclo[9.6.1.02,9.03,7.015,18]octadeca-11(18),12,14-triene-4,6,17-trione	present	LOTUS
(7,9-dimethyl-6,6a,8,9,10,10a-hexahydro-4H-indolo[4,3-fg]quinolin-10-yl) acetate	present	LOTUS
(8beta,9beta)-6,8-Dimethylergolin-9-yl acetate	present	LOTUS
3,5,7,3'-Tetramethoxy-4'-hydroxyflavone	present	NPASS
3,7-Dihydroxyflavone	present	NPASS
alpha-Cyclopiazonic acid	present	LOTUS
Aspertamarinolide A	present	LOTUS
Aspertamarinolide B	present	LOTUS
Aspertamarinolide C	present	LOTUS
Decatamariic acid	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus tamarii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections45

Countries11

The DNA barcodea real sequence read deposited for this species

ITSPZ359181.1 ↗250 bpIsrael · 2024

ACGT

TGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCAC …

Aspergillus tamarii isolate FE.1 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus tamarii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈38 807 518 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus tamarii0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.3% BUSCO

08Occurrence & distribution

Record type59 records

Wild obs. + sensor5

Museum / vouchered49

Cultivated / captive5

Origin

Native1

Range

Area of Occupancy AOO156 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 21 m · max 21 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 4 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 4≤10 km 1>10 km 1

6 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence49

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guasave, MX	4
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	2
ARMS-MBONlocation not on record	1
Odawara, JP	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
PHlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1

8 institutions · 12 of 49 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA45 detections

Where the DNA of Aspergillus tamarii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys6

Countries11

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map11 countries0

marine sedimentsIndomalayanNeotropicAfrotropicUnderwater Biotechnology Park; semi-industri…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 8.30–26.8

Seasonal swing summer↔winter5.00 °C

Max temp (day)27.9 °C 11.9–31.4

Min temp (night)19.3 °C 4.40–24.2

Precipitation105 mm/mo 41.9–267

Air humidity62.3 % 52.0–66.2

Moisture balance-25.4 mm/mo -109–125

Vapour deficit1,183 Pa 471–1,616

Wind speed2.80 m/s 1.50–4.00

Cloud cover30.4 % 19.5–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)