Aspergillus stellatus

Curzi · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records4

Data sources10

Biological traits0

DNA specimens1

eDNA detections127

Sources10 archives

Databases and archives Aspergillus stellatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI127 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS134 compounds

Occurrence & distributionGBIF4 records

Environmental DNA4 datasets · 7 countries127 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aspergillus stellatus is a species of fungus in the genus Aspergillus. It is from the Nidulantes section. The species was first described in 1934.Curzi, M. 1934, Rendic. Accad. naz. Lincei 19: 424-428 It has been isolated from soil in Panama and seeds in India. It has been reported in human infections. It has been reported to produce aflatoxin B1, ajamxanthone, shamixanthone, tajixanthone, tajixanthone hydrate, tajixanthone methanoate, 19-O-methyl-22- methoxypre-shamixanthone, pre-shamixanthone, 15- acetyltajixanthone hydrate, andibenin A, andibenin B, andibenin C, andelesin A, andelesin B, anditomin, arugosin A, arugosin B, arugosin D, asperthecin, astellatol, asteltoxin, desferritriacetylfusigen, dihydroterrein, emervaridione, varioxiranediol, epiisoshamixanthone, ophiobolin C, ophiobolin G, ophiobolin H, ophiobolin K, evariquinone, 2-Furanoic acid, islandicin, isoemericellin, kojic acid, 2-Methoxy-6-(3,4-dihydroxy-hepta-1,5-dienyl)benzyl alcohol, najamxanthone, radixanthone, shahenxanthone, penicillin G, shimalactone A, siderin, stellatic acid, stellatin, stromemycin, terrein, variecoacetal A, variecoacetal B, variecolactone, variecolin, varioxirane, varixanthone, varitriol, and varioxranol A-G.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition134 compounds

Compounds documented for Aspergillus stellatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Indole diketopiperazine alkaloids (L-Trp, L-Ala)37

Methyl xanthones15

Tetraketide meroterpenoids12

Simple aromatic polyketides12

Ophiobolane sesterterpenoids9

Documented compounds134 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-neoechinulin A	present	LOTUS
(-)-Neoechinulin A; Neoechinuline A	present	LOTUS
(-)-Varitriol	present	LOTUS
(1E,3R,4S,5E)-1-[2-(hydroxymethyl)-3-methoxyphenyl]hepta-1,5-diene-3,4-diol	present	LOTUS
(1R,17S)-7,11-dihydroxy-6-[(2R)-2-hydroxy-3-methylbut-3-enyl]-17-(2-hydroxypropan-2-yl)-13-methyl-2,15-dioxatetracyclo[8.7.1.03,8.014,18]octadeca-3(8),4,6,10,12,14(18)-hexaen-9-one	present	LOTUS
(1R,2S)-2,3-Dihydro-1,11-dihydroxy-5-methyl-8-(3-methyl-2-buten-1-yl)-2-(1-methylethenyl)pyrano(3,2-a)xanthen-12(1H)-one	present	LOTUS
(1R,2S,3R,9R,12S,14R,16S,20S)-3,8,8,14-tetramethyl-21-methylidene-7,18-dioxahexacyclo[12.7.1.02,12.03,9.012,20.016,20]docos-4-ene-6,17,22-trione	present	LOTUS
(1R,3S,4R,7R,8E,11S,12R)-4-hydroxy-1,4-dimethyl-12-[(2S)-6-methylhept-5-en-2-yl]-6-oxotricyclo[9.3.0.03,7]tetradec-8-ene-8-carbaldehyde	present	LOTUS
(1R,3S,4R,7R,8E,11S,12R)-4-hydroxy-1,4-dimethyl-12-[(2S,3Z)-6-methylhepta-3,5-dien-2-yl]-6-oxotricyclo[9.3.0.03,7]tetradec-8-ene-8-carbaldehyde	present	LOTUS
(1R,3S,4R,7S,8E,11S,12R)-4-hydroxy-1,4-dimethyl-12-[(2S,3Z)-6-methylhepta-3,5-dien-2-yl]-6-oxotricyclo[9.3.0.03,7]tetradec-8-ene-8-carbaldehyde	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus stellatus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections127

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPZ401092.1 ↗427 bpIraq · 2021

ACGT

CAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCCCCCCAGGGGCGAGCCGCCGGGGACCACTGAACTTCATGCCTG …

Aspergillus stellatus isolate LAS internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

09Environmental DNA127 detections

Where the DNA of Aspergillus stellatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found127

Studies independent surveys4

Countries7

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 127 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.22 4.50–7.95

Conductivity567 µS/cm 34.0–1,100

Organic carbon0.4 % 0.3–0.5

Nitrate-N4.60 mg/kg

Phosphorus13.0 mg/kg

Clay22.3 % 3.93–40.6

Sand67.2 % 41.3–93.1

Depth0.2 m

SoilTenosolVertosols

2 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 24.8–27.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)31.8 °C 27.1–33.8

Min temp (night)23.1 °C 20.9–24.8

Precipitation9.90 mm/mo 4.50–218

Air humidity58.7 % 56.1–63.7

Moisture balance-113 mm/mo -161–62.4

Vapour deficit1,459 Pa 1,148–1,536

Wind speed2.40 m/s 1.70–7.40

Cloud cover24.9 % 18.0–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 119 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)