Aspergillus sojae

Sakag. & K.Yamada ex Murak. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records7

Data sources10

Biological traits0

DNA specimens3

eDNA detections6

Sources10 archives

Databases and archives Aspergillus sojae's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF7 records

Environmental DNA4 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈40 Mbp

01Narrative

Aspergillus sojae is a species of fungus in the genus Aspergillus. In Japan, it is used to make the ferment (kōji) of soy sauce, miso, mirin, and other lacto-fermented condiments such as tsukemono. Soy sauce condiment is produced by fermenting soybeans with A. sojae, along with water and salt. Glyceollins, molecules belonging to the pterocarpans, are found in the soybean (Glycine max) and have been found to have an antifungal activity against A. sojae. Aspergillus sojae contains 10 glutaminase genes. The glutaminase enzyme in A. sojae is important to the taste of the soy sauce that it produces. An experiment was conducted using the genome sequencing of A. sojae. Strain NBRC 4239 had been isolated from the koji used to prepare Japanese soy sauce. The sequencing technology was used to investigate the genome with respect to enzymes and secondary metabolites in comparison with other Aspergillus species sequenced. The A. sojae NBRC4239 genome data will be useful to characterize functional features of the koji moulds used in Japanese industries.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition3 compounds

Compounds documented for Aspergillus sojae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pterocarpan3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
Glyceollin I	present	LOTUS
Glyceollin Ii	present	LOTUS
Glyceollin Iii	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus sojae has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMK651574.1 ↗500 bp

ACGT

GTACCTTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGCGTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGT …

Aspergillus sojae strain 146 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus sojae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈40 106 795 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aspergillus sojae0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness95% BUSCO

08Occurrence & distribution

Record type7 records

Museum / vouchered7

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	1

1 institutions · 1 of 7 vouchered records shown · 5 without an institution code

09Environmental DNA6 detections

Where the DNA of Aspergillus sojae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys4

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 9.40–25.4

Seasonal swing summer↔winter13.2 °C

Max temp (day)19.7 °C 11.6–27.7

Min temp (night)13.6 °C 5.10–22.1

Precipitation274 mm/mo 218–330

Air humidity66.3 % 65.2–67.5

Moisture balance163 mm/mo 83.6–243

Vapour deficit802 Pa 503–1,102

Wind speed2.10 m/s 1.40–2.70

Cloud cover48.8 % 45.4–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)