Aspergillus silvaticus

Fennell & Raper · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records2

Data sources8

Biological traits0

DNA specimens0

eDNA detections27

Sources8 archives

Databases and archives Aspergillus silvaticus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS3 compounds

Occurrence & distributionGBIF2 records

Environmental DNA6 datasets · 6 countries27 detections

DNA & barcodingNCBIsequences

01Narrative

Aspergillus silvaticus is a species of fungus in the genus Aspergillus. It is from the Silvati section. The species was first described in 1955.Fennell, D.I.; Raper, K.B. 1955. New species and varieties of Aspergillus. Mycologia. 47:68-89

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition3 compounds

Compounds documented for Aspergillus silvaticus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthraquinones and anthrones2

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
Emodin	present	NPASS
Skyrin	present	NPASS
SMIDBNIORCUJSX-IYBDPMFKSA-N	present	NPASS

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus silvaticus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences9

eDNA detections27

Countries6

The DNA barcodea real sequence read deposited for this species

ITSOP710004.1 ↗544 bpIran · 2018

ACGT

GGAATCTTGGGACGTGGTAATCTGCGGCCCTCCCCTGGGATCCTTCCCTGTTGTCGGGGGAGCCCCTTTCCCTTTCCCGGGAAAGGGGCG …

Aspergillus silvaticus isolate 8B7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

09Environmental DNA27 detections

Where the DNA of Aspergillus silvaticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys6

Countries6

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map6 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.50

Conductivity27.0 µS/cm

Organic carbon1.08 %

Nitrate-N5.00 mg/kg

Phosphorus2.00 mg/kg

Clay25.6 %

Sand56.9 %

Depth0.2 m

SoilHydrosol

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 14.5–27.0

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.9 °C 19.2–28.7

Min temp (night)24.9 °C 9.00–25.4

Precipitation211 mm/mo 122–299

Air humidity63.8 % 61.0–67.0

Moisture balance77.6 mm/mo

Vapour deficit1,150 Pa 645–1,281

Wind speed4.80 m/s

Cloud cover37.9 % 25.1–55.2

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)