Aspergillus sepultus — The Life Data

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources7

Biological traits0

DNA specimens1

eDNA detections3

Sources7 archives

Databases and archives Aspergillus sepultus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Environmental DNA3 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aspergillus sepultus is a species of fungus in the genus Aspergillus. It is from the Cremei section. The species was first described in 1986.Tuthill, D.E.; Christensen, M. 1986. Aspergillus sepultus, a new species in the Aspergillus ochraceus group. Mycologia. 78(3):475-477

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus sepultus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSFJ531074.1 ↗455 bp

ACGT

CCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCATTCGTGGCCGCCGGGGGGCATCTCGCCCCCGGGCCCGCGCCCG …

Aspergillus sepultus strain CBS 257.85 internal transcribed spacer 1, partial sequence; 5.8 S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

09Environmental DNA3 detections

Where the DNA of Aspergillus sepultus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.