Aspergillus sclerotiorum

G.A.Huber · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records15

Data sources11

Biological traits0

DNA specimens20

eDNA detections19

Sources11 archives

Databases and archives Aspergillus sclerotiorum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS80 compounds

Occurrence & distributionGBIF15 records

Environmental DNA3 datasets · 2 countries19 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceGoaT · NCBI≈36 Mbp

01Narrative

Aspergillus sclerotiorum is a species of fungus in the genus Aspergillus. It is from the Circumdati section. The species was first described in 1933. A. sclerotiorum has been reported to produce penicillic acid, xanthomegnin, viomellein, and vioxanthin. In 2016, the genome of A. sclerotiorum was sequenced as a part of the Aspergillus whole-genome sequencing project - a project dedicated to performing whole-genome sequencing of all members of the genus Aspergillus. The genome assembly size was 37.97 Mbp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition80 compounds

Compounds documented for Aspergillus sclerotiorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclic peptides19

Indole diketopiperazine alkaloids (L-Trp, L-Pro)13

Monacolins and Monacolin derivatives11

Arteminisin3

Simple indole alkaloids2

Documented compounds80 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-(4S,5S)-4-hydroxy-3-methoxy-5-methyl-2-cyclopentenone	present	LOTUS
(+)-aspersclerolide D	present	LOTUS
(+/-)-sclerotiorumin A	present	LOTUS
(-)-(4R,5R)-4-hydroxy-3-methoxy-5-methyl-2-cyclopentenone	present	LOTUS
(-)-aspersclerolide D	present	LOTUS
(-)-Mefloquine	present	LOTUS
(2E,4E,7S)-7-hydroxy-6-oxo-N-[(3S,6S,9S)-3,4,7-trimethyl-2,5,8-trioxo-6-propan-2-yl-1,4,7-triazacyclododec-9-yl]octa-2,4-dienamide	present	LOTUS
(2R)-2-[2-[(1S,2S)-2,6-dimethyl-1,2-dihydronaphthalen-1-yl]ethyl]-2,3-dihydropyran-6-one	present	LOTUS
(8alpha)-sclerotiorumin B	present	LOTUS
(8beta)-sclerotiorumin B	present	LOTUS

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus sclerotiorum has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes4

GenBank sequences10

eDNA detections19

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMH857270.1 ↗547 bpItaly

ACGT

CATTACTGAGTGAGGGTCCCTCGGGGCCCAACCTCCCACCCGTGTATACCGTACCTTGTTGCTTCGGCGGGCCCGCCGCGCAAGCGGCCG …

Aspergillus sclerotiorum strain CBS 138.54 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus sclerotiorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈35 883 475 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus sclerotiorum0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type15 records

Wild obs. + sensor1

Museum / vouchered13

Cultivated / captive1

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence13

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	1

3 institutions · 3 of 13 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA19 detections

Where the DNA of Aspergillus sclerotiorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys3

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 21.4–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)31.9 °C 24.8–31.9

Min temp (night)23.6 °C 17.2–23.6

Precipitation137 mm/mo 63.7–137

Air humidity59.8 % 57.2–59.8

Moisture balance-8.90 mm/mo -68.3–-8.90

Vapour deficit1,523 Pa 1,179–1,523

Wind speed2.20 m/s 2.20–3.30

Cloud cover38.6 % 35.0–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)