Aspergillus restrictus

G.Sm. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records38

Data sources11

Biological traits0

DNA specimens9

eDNA detections39

Sources11 archives

Databases and archives Aspergillus restrictus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility34 records↗

OBISOcean Biodiversity Information System4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF · OBIS38 records

Environmental DNA8 datasets · 12 countries39 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Aspergillus restrictus is a species of fungus in the genus Aspergillus. It is from the Restricti section. The species was first described in 1931.Smith, G. 1931, J. Textile Res. Inst. 22: 115 It is xerophilic, frequently found in house dust. Studies have suggested that it is an allergen implicated in asthma. In 2016, the genome of A. restrictus was sequenced as a part of the Aspergillus whole-genome sequencing project - a project dedicated to performing whole-genome sequencing of all members of the genus Aspergillus. The genome assembly size was 23.26 Mbp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition11 compounds

Compounds documented for Aspergillus restrictus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones6

Indole diketopiperazine alkaloids (L-Trp, L-Ala)4

Dipeptides1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,6S)-3-[(R)-hydroxy-[2-(2-methylbut-3-en-2-yl)-6,7-bis(3-methylbut-2-enyl)-1H-indol-3-yl]methyl]-6-methylpiperazine-2,5-dione	present	LOTUS
5,5'-dihydroxy-2,2'-bis(4-hydroxyphenyl)-7,7'-dimethoxy-4H,4'H-[6,8'-bichromene]-4,4'-dione	present	NPASS
5,7-Dihydroxy-8-[5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4-oxochromen-6-yl]-2-(4-hydroxyphenyl)chromen-4-one	present	NPASS
5,7-Dihydroxy-8-[5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4-oxochromen-6-yl]-2-(4-methoxyphenyl)chromen-4-one	present	NPASS
5,7-Dihydroxy-8-[5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4-oxochromen-8-yl]-2-(4-hydroxyphenyl)chromen-4-one	present	NPASS
5-Hydroxy-8-[5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4-oxochromen-8-yl]-2-(4-hydroxyphenyl)-7-methoxychromen-4-one	present	NPASS
Arestrictin A	present	LOTUS
Arestrictin B	present	LOTUS
Aurantiamide Acetate	present	LOTUS
Cristatin A	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus restrictus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences10

eDNA detections39

Countries12

The DNA barcodea real sequence read deposited for this species

ITSPV259750.1 ↗410 bpChina · 2019

ACGT

CGGGCCCGCCTTCATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCGCCGGAGACTCCAACATTGAACACTGTCTGAAGGTTGCA …

Aspergillus restrictus isolate XSF57 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor2

Museum / vouchered36

Range

Area of Occupancy AOO88 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 22 m · max 22 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ARMS-MBONlocation not on record	1
Zürich, CH	1
Pullman, US	1
DPIlocation not on record	1
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	1

5 institutions · 5 of 36 vouchered records shown · 27 without an institution code

09Environmental DNA39 detections

Where the DNA of Aspergillus restrictus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys8

Countries12

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map12 countries0

IndomalayanMarine Protected Area; protected; 9.2 - Subt…AfrotropicNeotropicAustralasia

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature22.3 °C 21.9–26.7

pH7.16 7.06–7.25

Salinity28.9 PSU 28.3–29.6

Turbidity1.95 NTU 0–3.90

Depth0 m

Coastal waterSediment

3 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 17.6–24.5

Seasonal swing summer↔winter4.40 °C

Max temp (day)26.2 °C 20.7–29.2

Min temp (night)19.2 °C 13.6–20.8

Precipitation130 mm/mo 17.6–258

Air humidity65.9 % 54.9–72.1

Moisture balance7.40 mm/mo -95.1–132

Vapour deficit855 Pa 694–1,185

Wind speed2.10 m/s 1.50–3.90

Cloud cover36.4 % 18.8–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)