Aspergillus recurvatus

Raper & Fennell · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records3

Data sources9

Biological traits0

DNA specimens1

eDNA detections6

Sources9 archives

Databases and archives Aspergillus recurvatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 records

Environmental DNA4 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈31 Mbp

01Narrative

Aspergillus recurvatus is a species of fungus in the genus Aspergillus. It is from the Nidulantes section. The species was first described in 1965.Raper, K.B.; Fennell, D.I. 1965. The Genus Aspergillus. :1-686 In 2016, the genome of A. recurvatus was sequenced as a part of the Aspergillus whole-genome sequencing project - a project dedicated to performing whole-genome sequencing of all members of the genus Aspergillus. The genome assembly size was 30.72 Mbp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus recurvatus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences7

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMG596649.1 ↗533 bpNigeria · 2017

ACGT

GGGGCTGCCTCCGGGGCGCCCAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCTCCCCAGGGGGCGAGCCGCCGGG …

Aspergillus recurvatus strain NW-53 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus recurvatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈30 717 846 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus recurvatus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type3 records

Museum / vouchered3

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

09Environmental DNA6 detections

Where the DNA of Aspergillus recurvatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys4

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

PalearcticAfrotropicNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 0.2–25.0

Seasonal swing summer↔winter7.60 °C

Max temp (day)27.7 °C 4.60–28.8

Min temp (night)14.2 °C -5.80–21.9

Precipitation67.9 mm/mo 16.4–98.6

Air humidity57.9 % 47.8–63.2

Moisture balance-40.0 mm/mo -137–-1.60

Vapour deficit1,183 Pa 406–1,360

Wind speed3.80 m/s 2.30–4.70

Cloud cover30.9 % 20.5–31.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)