Aspergillus pulvinus

Kwon-Chung & Fennell · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records15

Data sources9

Biological traits0

DNA specimens2

eDNA detections69

Sources9 archives

Databases and archives Aspergillus pulvinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS14 compounds

Occurrence & distributionGBIF15 records

Environmental DNA4 datasets · 14 countries69 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Aspergillus pulvinus is a species of fungus in the genus Aspergillus. It is from the Cremei section. The species was first described in 1965.Raper, K.B.; Fennell, D.I. 1965. The Genus Aspergillus. :1-686

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition14 compounds

Compounds documented for Aspergillus pulvinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

2-arylbenzofurans7

Stemona alkaloids4

Monomeric stilbenes1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(11E)-(2'S)-Hydroxystemofoline	present	NPASS
(2S)-2-[(2R)-2-[(9R,9aS)-2,3,5,6,7,8,9,9a-octahydro-1H-pyrrolo[1,2-a]azepin-9-yl]propyl]-4-methyl-2H-furan-5-one	present	NPASS
(3R,5S)-5-[(2R)-2-[(4R,9R,9aS)-4-oxido-2,3,5,6,7,8,9,9a-octahydro-1H-pyrrolo[1,2-a]azepin-4-ium-9-yl]propyl]-3-methyloxolan-2-one	present	NPASS
Stemaphylline	present	NPASS
Stemofuran E	present	NPASS
Stemofuran F	present	NPASS
Stemofuran J	present	NPASS
Stemofuran M	present	NPASS
Stemofuran N	present	NPASS
Stemofuran O	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus pulvinus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections69

Countries14

The DNA barcodea real sequence read deposited for this species

ITSFJ531048.1 ↗456 bp

ACGT

CCTCCCACCCTTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCATTCGTGGCCGCCGGGGGGCATCTGCCCCCGGGCCCGCGCCCGC …

Aspergillus pulvinus strain CBS 578.65 internal transcribed spacer 1, partial sequence; 5.8 S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor1

Museum / vouchered14

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 1

6 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	2
Madison, US	2
PHlocation not on record	2
Catholic University of Pekinglocation not on record	2

4 institutions · 8 of 14 vouchered records shown · 6 without an institution code

09Environmental DNA69 detections

Where the DNA of Aspergillus pulvinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys4

Countries14

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map14 countries0

PalearcticNearcticNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 14.8–28.2

Seasonal swing summer↔winter2.60 °C

Max temp (day)30.5 °C 20.2–33.8

Min temp (night)23.1 °C 11.0–25.2

Precipitation62.7 mm/mo 9.90–270

Air humidity58.9 % 51.2–65.2

Moisture balance-12.8 mm/mo

Vapour deficit1,434 Pa 731–1,717

Wind speed3.00 m/s

Cloud cover24.9 % 18.2–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)