Aspergillus pseudodeflectus

Samson & Mouch. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records8

Data sources11

Biological traits0

DNA specimens11

eDNA detections21

Sources11 archives

Databases and archives Aspergillus pseudodeflectus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS43 compounds

Occurrence & distributionGBIF8 records

Environmental DNA4 datasets · 8 countries21 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceGoaT · NCBI≈39 Mbp

01Narrative

Aspergillus pseudodeflectus is a species of fungus in the genus Aspergillus. It is from the Usti section. The species was first described in 1975.Samson, R.A.; Mouchacca, J. 1975. Additional notes on species of Aspergillus, Eurotium and Emericella from Egyptian desert soil. Antonie van Leeuwenhoek. 41(3):343-351 It has been reported to produce drimans, ophiobolins G and H, and austins.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition43 compounds

Compounds documented for Aspergillus pseudodeflectus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dibenzylbutyrolactone lignans11

Drimane sesquiterpenoids6

Cinnamic acids and derivatives4

Simple phenolic acids3

Stigmastane steroids3

Documented compounds43 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pseudodeflectusin	present	LOTUS
(-)-Haplomyrfolin	present	NPASS
(-)-Matairesinol	present	NPASS
(1R,4R,5R,9S)-4,5-epoxycaryophyllan-8(13)-ene	present	NPASS
(2E,4E)-2,4-Hexadienoic acid (1-oxo-6,6,9abeta-trimethyl-9balpha-hydroxy-1,3,5,5aalpha,6,7,8,9,9a,9b-decahydronaphtho[1,2-c]furan)-5beta-yl ester	present	LOTUS
(2E,4E,10E)-11-(4-methoxyphenyl)-N-(2-methylpropyl)undeca-2,4,10-trienamide	present	NPASS
(2R,3R)-2-(1,3-benzodioxol-5-ylmethyl)-3-[(4-hydroxy-3-methoxyphenyl)methyl]butane-1,4-diol	present	NPASS
(3E,4R)-3-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]-4-[(3,4,5-trimethoxyphenyl)methyl]oxolan-2-one	present	NPASS
(3E,4R)-4-(1,3-benzodioxol-5-ylmethyl)-3-[(3,4-dihydroxyphenyl)methylidene]oxolan-2-one	present	NPASS
(3R,4R)-3-(1,3-benzodioxol-5-ylmethyl)-4-[(3,4-dihydroxyphenyl)methyl]oxolan-2-one	present	NPASS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus pseudodeflectus has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes1

GenBank sequences10

eDNA detections21

Countries8

The DNA barcodea real sequence read deposited for this species

ITSMH860894.1 ↗505 bpEgypt

ACGT

GGAAGGATCATTACCGAGTGCAGGTCTGCCCCCGGGCAGGCCTAACCTCCCACCCGTGAATACCTGACCAACGTTGCTTCGGCGGTGCGC …

Aspergillus pseudodeflectus strain CBS 756.74 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus pseudodeflectus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈39 072 803 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus pseudodeflectus0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO32 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

09Environmental DNA21 detections

Where the DNA of Aspergillus pseudodeflectus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys4

Countries8

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map8 countries0

IndomalayanAfrotropicNeotropicPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 15.5–26.7

Seasonal swing summer↔winter10.6 °C

Max temp (day)28.3 °C 20.2–31.6

Min temp (night)19.0 °C 10.4–22.0

Precipitation86.9 mm/mo 31.9–127

Air humidity60.1 % 50.2–62.9

Moisture balance-55.7 mm/mo -107–24.7

Vapour deficit1,199 Pa 707–1,558

Wind speed2.10 m/s 1.90–3.40

Cloud cover32.8 % 17.1–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)