Aspergillus petrakii — The Life Data

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources10

Biological traits0

DNA specimens1

eDNA detections2

Sources10 archives

Databases and archives Aspergillus petrakii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS6 compounds

Environmental DNA2 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aspergillus petrakii is a species of fungus in the genus Aspergillus. It is from the Circumdati section. The species was first described in 1957.Vörös, J. 1957. A new species of Aspergillus from Leptinotarsa decemlineata Say. Beihefte zur Sydowia. 1:62-63

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition6 compounds

Compounds documented for Aspergillus petrakii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Stigmastane steroids1

Miscellaneous polyketides1

Dipeptides1

Simple phenolic acids1

Anthraquinones and anthrones1

Documented compounds6 total

Compound	Amount	Source
3,5-Dihydroxy-2,4-dimethoxyfluoren-9-one	present	NPASS
Aurantiamide Acetate	present	NPASS
beta-Sitosterol	present	NPASS
Dimethyl terephthalate	present	NPASS
KXKLIIDALHFICZ-UHFFFAOYSA-N	present	NPASS
Patulin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus petrakii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences8

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF203798.1 ↗445 bp

ACGT

CATTATGAGTGAGGGTCCTCGGGGCCAACTCCCACCGTGTATACCGTACCTTGTTGCTTCGGCGAGCCCGCCCCCTTTTCTTTTAGGGGG …

Aspergillus petrakii IMI 172291 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8 S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS8

fungal barcode

09Environmental DNA2 detections

Where the DNA of Aspergillus petrakii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.