Aspergillus penicillioides

Speg. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records265

Data sources10

Biological traits0

DNA specimens17

eDNA detections4 069

Sources10 archives

Databases and archives Aspergillus penicillioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 069 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF265 records

Environmental DNA13 datasets · 29 countries4 069 detections

DNA & barcodingBOLD · NCBI17 specimens

01Narrative

Aspergillus vitricola is a species of fungus in the genus Aspergillus. It is from the Robusti section. The species was first described in 1962 by Ohtsuki.Ohtsuki, T. 1962. Studies on the glass mould: On two species of Aspergillus isolated from glass. Botanical Magazine Tokyo. 75:436-442 It has been isolated from binocular lenses in Japan and house dust in Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Aspergillus penicillioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Dipeptides2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(2s)-2-[(n-Benzoylphenylalanyl)amino]-3-phenylpropyl acetate		present	LOTUS
[(2R)-2-[[[(2S)-2-benzamido-3-phenylpropanoyl]amino]methyl]-3-phenylpropyl] acetate		present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus penicillioides has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes4

GenBank sequences10

eDNA detections4 069

Countries29

The DNA barcodea real sequence read deposited for this species

ITSPV662127.1 ↗484 bpBrazil · 2023

ACGT

CCATCCGTGTCTATTTGTACCCTGTTGCTTCGGCGGGCCCGCCCTTCGTGGCCGCCGGGGGGCTTCCCTGCCCCCGGGCCCGTGCCCGCC …

Aspergillus penicillioides strain COAD:3582 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

08Occurrence & distribution

Record type265 records

Wild obs. + sensor1

Museum / vouchered264

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 264 records without

Open the institutions mapphysical evidence264

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ARMS-MBONlocation not on record	1

1 institutions · 1 of 264 vouchered records shown · 263 without an institution code

09Environmental DNA4 069 detections

Where the DNA of Aspergillus penicillioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4 069

Studies independent surveys13

Countries29

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 069 detections have coordinates

Open the map29 countries0

deep-sea sediment from South China SeaAfrotropicNeotropicPine(Softwood) dowel buried in soil of a mix…Marina; semi-industrial; 9.3 - Subtidal Loos…Pine(Softwood) dowel buried in soil of a con…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature18.0 °C 15.0–28.0

pH6.32 4.00–9.30

Conductivity125 µS/cm 10.0–117,000

Organic carbon1.02 % 0.04–13.8

Water content9.15 % 0.363–48.5

Nitrate-N5.35 mg/kg 0.5–510

Phosphorus18.0 mg/kg 2.00–604

Clay20.3 % 0.94–60.8

Sand64.1 % 17.4–96.0

Depth0 m 0–0.2

SoilVertosolTenosolDermosolsVertosolsHydrosolCalcarosol

122 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 24.2–26.4

Seasonal swing summer↔winter0.6 °C

Max temp (day)27.2 °C 27.2–28.8

Min temp (night)22.5 °C 21.6–23.1

Precipitation422 mm/mo 127–422

Air humidity69.9 % 63.8–69.9

Moisture balance276 mm/mo 6.70–276

Vapour deficit925 Pa 925–1,077

Wind speed1.60 m/s 1.00–4.00

Cloud cover57.4 % 38.3–57.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 049 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)