Aspergillus parvulus

G.Sm. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records2

Data sources9

Biological traits0

DNA specimens8

eDNA detections10

Sources9 archives

Databases and archives Aspergillus parvulus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF2 records

Environmental DNA3 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Aspergillus parvulus is a species of fungus in the genus Aspergillus. It is from the Cervini section. The species was first described in 1961.Smith, G. 1961. Some new and interesting species of micro-fungi. II. Transactions of the British Mycological Society. 44(1):42-50 It was isolated from soil in the United States and from feed ingredients in Argentina. A. parvulus has been reported to produce naphthalenones. The genome of A. parvulus was sequenced as a part of the Aspergillus whole-genome sequencing project - a project dedicated to performing whole-genome sequencing of all members of the genus Aspergillus. The genome assembly size was 32.73 Mbp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition11 compounds

Compounds documented for Aspergillus parvulus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Guaiane sesquiterpenoids3

Naphthalenones2

Ansa peptide alkaloids2

Chromones1

Apotirucallane triterpenoids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,5R,6S,7S,10S,14R,15R,16S,21R)-6,7,16-trihydroxy-1,2,5,8,8,15,20,20-octamethyl-19-oxapentacyclo[12.9.0.02,11.05,10.015,21]tricos-11-ene-18,23-dione	present	NPASS
(2S)-2-(dimethylamino)-3-methyl-N-[(3S,4S,7S,10Z)-7-(2-methylpropyl)-5,8-dioxo-3-propan-2-yl-2-oxa-6,9-diazabicyclo[10.2.2]hexadeca-1(14),10,12,15-tetraen-4-yl]butanamide	present	NPASS
(2S,3R,4R,5R,6S)-2-[[(1S,2R,3R)-7-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-3-(hydroxymethyl)-6-methoxy-1,2,3,4-tetrahydronaphthalen-2-yl]methoxy]-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3S)-2-(dimethylamino)-N-[(2Z,6S,9S,10S)-6-isobutyl-10-isopropyl-5,8-dioxo-11-oxa-4,7-diazabicyclo[10.2.2]hexadeca-1(14),2,12,15-tetraen-9-yl]-3-methyl-pentanamide	present	NPASS
(6R,8S,8aR)-6-hydroxy-3,8-dimethyl-5-propan-2-yl-6,7,8,8a-tetrahydro-1H-azulen-2-one	present	NPASS
(8S,8aR)-3,8-dimethyl-5-propan-2-yl-1,7,8,8a-tetrahydroazulene-2,6-dione	present	NPASS
(8S,8aR)-5-[(2S)-1-hydroxypropan-2-yl]-3,8-dimethyl-6,7,8,8a-tetrahydro-1H-azulen-2-one	present	NPASS
2-Hexyl-5-hydroxy-7-methoxychromen-4-one	present	NPASS
Asparvenone	present	LOTUS
Cleomiscosin A	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus parvulus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes1

GenBank sequences9

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOK036300.1 ↗356 bp

ACGT

GCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCC …

Aspergillus parvulus isolate KVP1RB1A 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Institution	Specimens
DPIlocation not on record	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Aspergillus parvulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys3

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.50 °C 7.50–7.50

Seasonal swing summer↔winter12.1 °C

Max temp (day)11.6 °C

Min temp (night)3.20 °C

Precipitation265 mm/mo

Air humidity62.8 %

Moisture balance153 mm/mo

Vapour deficit385 Pa

Wind speed8.70 m/s

Cloud cover39.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)