Aspergillus parasiticus

Speare · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records77

Data sources11

Biological traits0

DNA specimens26

eDNA detections34

Sources11 archives

Databases and archives Aspergillus parasiticus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS18 compounds

Occurrence & distributionGBIF77 records

Environmental DNA3 datasets · 2 countries34 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceGoaT · NCBI≈41 Mbp

01Narrative

Aspergillus parasiticus is a fungus belonging to the genus Aspergillus. This species is an unspecialized saprophytic mold, mostly found outdoors in areas of rich soil with decaying plant material as well as in dry grain storage facilities. Often confused with the closely related species, A. flavus, A. parasiticus has defined morphological and molecular differences. Aspergillus parasiticus is one of three fungi able to produce the mycotoxin, aflatoxin, one of the most carcinogenic naturally occurring substances. Environmental stress can upregulate aflatoxin production by the fungus, which can occur when the fungus is growing on plants that become damaged due to exposure to poor weather conditions, during drought, by insects, or by birds. In humans, exposure to A. parasiticus toxins can cause delayed development in children and produce serious liver diseases and/or hepatic carcinoma in adults. The fungus can also cause the infection known as aspergillosis in humans and other animals. A. parasiticus is of agricultural importance due to its ability to cause disease in corn, peanut, and cottonseed.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition18 compounds

Compounds documented for Aspergillus parasiticus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Anthraquinones and anthrones3

Aflatoxins1

Flavones1

Pyridine alkaloids1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
2-(1,4-Dihydroxybutan-2-yl)-1,3,6,8-tetrahydroxy-9,10-anthraquinone	present	NPASS
3-Chloro-4,5-Dihydroxybenzyl Alcohol	present	NPASS
6,7,4'-Trihydroxyflavone	present	NPASS
6,7,8-Trihydroxy-2-(4-Hydroxyphenyl)Chromen-4-One	present	NPASS
Aflatoxin M1	present	NPASS
BWYUKBCRHDFWFF-UHFFFAOYSA-N	present	NPASS
FADKCPNHKVEUDT-RUDMXATFSA-N	present	NPASS
Gentisyl Alcohol	present	NPASS
Parasitenone	present	NPASS
Pestalamide B	present	NPASS

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus parasiticus has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes2

GenBank sequences10

eDNA detections34

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPX533088.1 ↗507 bpIndia · 2024

ACGT

TCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGCGTCAGCCCCG …

Aspergillus parasiticus isolate AP06 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_041445 ↗ · 17 protein · 26 tRNA · 2 rRNA

cobnad1hypothetical proteinnad4atp8atp6nad6cox3rps5cox1intron-encoded LAGLIDADG endonucleaseatp9nad3cytochrome oxidase subunit 2nad4Lnad5nad2rnsrnl

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus parasiticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈41 424 979 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aspergillus parasiticus0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.2% BUSCO

08Occurrence & distribution

Record type77 records

Wild obs. + sensor5

Museum / vouchered71

Cultivated / captive1

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence71

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	5
UFPElocation not on record	3
BDBClocation not on record	1
Pullman, US	1
ILLSlocation not on record	1
DPIlocation not on record	1

6 institutions · 12 of 71 vouchered records shown · 59 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA34 detections

Where the DNA of Aspergillus parasiticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys3

Countries2

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 9.00–21.3

Seasonal swing summer↔winter14.2 °C

Max temp (day)18.6 °C 11.4–25.8

Min temp (night)10.7 °C 4.60–16.8

Precipitation214 mm/mo 109–318

Air humidity63.5 % 62.3–64.7

Moisture balance108 mm/mo -15.1–232

Vapour deficit747 Pa 492–1,002

Wind speed2.00 m/s 1.30–2.70

Cloud cover41.0 % 38.2–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)