Aspergillus ostianus

Wehmer · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records7

Data sources12

Biological traits0

DNA specimens8

eDNA detections11

Sources12 archives

Databases and archives Aspergillus ostianus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS31 compounds

Occurrence & distributionGBIF7 records

Environmental DNA4 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceGoaT · NCBI≈36 Mbp

01Narrative

Aspergillus ostianus is a species of fungus in the genus Aspergillus. It is from the Circumdati section. The species was first described in 1899.Wehmer 1899, Bot. Centralbl. 80: 461 It has been reported to produce ochratoxin A.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition31 compounds

Compounds documented for Aspergillus ostianus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Macrolide lactones10

Ursane and Taraxastane triterpenoids6

Fatty alcohols5

2-pyrone derivatives4

Acetogenins3

Documented compounds31 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bR)-1,10,11-trihydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	NPASS
(1R,2R,4aS,6aR,6aS,6bR,8aR,10R,12aR,14bR)-1,10-dihydroxy-1,2,6a,6b,9,9,12a-heptamethyl-11-oxo-3,4,5,6,6a,7,8,8a,10,12,13,14b-dodecahydro-2H-picene-4a-carboxylic acid	present	NPASS
(1S,2R,4aS,6aR,6aS,6bR,8aR,10S,12aR,14bR)-10-hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	NPASS
(1S,5R,11R,14S)-14-hydroxy-5-methyl-4,15-dioxabicyclo[9.3.1]pentadec-9-en-3-one	present	LOTUS
(1S,5R,9E,11R,14S)-14-hydroxy-5-methyl-4,15-dioxabicyclo[9.3.1]pentadec-9-en-3-one	present	LOTUS
(1S,5S,11R,14S)-14-hydroxy-5-methyl-4,15-dioxabicyclo(9.3.1)pentadec-9-en-3-one	present	LOTUS
(1S,5S,9E,11S,14S)-14-hydroxy-5-methyl-4,15-dioxabicyclo(9.3.1)pentadeca-9,12-dien-3-one	present	LOTUS
(2R)-4-[(1R,2S)-1-chloro-2-hydroxypropyl]-2-[(1S)-1-hydroxyethyl]-2H-furan-5-one	present	LOTUS
(2R,3R,4S,4aR,6aR,6bS,8aS,11R,12R,12aS,14aR,14bR)-2-acetyloxy-3,12-dihydroxy-4,6a,6b,11,12,14b-hexamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,11,12a,14,14a-tetradecahydropicene-4-carboxylic acid	present	NPASS
(2R,3S)-5-[(1S,2R)-2-chloro-1-hydroxypropyl]-3-hydroxy-2-methyl-2,3-dihydropyran-6-one	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus ostianus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes1

GenBank sequences10

eDNA detections11

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOQ299498.1 ↗494 bp

ACGT

TTGTTGCTTCGGCGAGCCCGCCCCCCCGTCCTTCGGGGGAGCACAGCGCTCGCCGGAGACACCAACGTGAACACTGTCTGAAGTTTTGTC …

Aspergillus ostianus isolate AN15 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus ostianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈35 685 113 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus ostianus0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type7 records

Wild obs. + sensor1

Museum / vouchered6

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA11 detections

Where the DNA of Aspergillus ostianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys4

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature26.0 °C

pH7.70

Conductivity108 µS/cm

Organic carbon0.69 %

Nitrate-N10.0 mg/kg

Phosphorus15.0 mg/kg

Clay11.8 %

Sand86.2 %

Depth0.2 m

SoilTenosol

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–16.4

Seasonal swing summer↔winter12.3 °C

Max temp (day)22.9 °C

Min temp (night)10.7 °C

Precipitation26.4 mm/mo

Air humidity52.3 %

Moisture balance-113 mm/mo

Vapour deficit891 Pa

Wind speed4.40 m/s

Cloud cover15.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)