Aspergillus ochraceoroseus

Bartoli & Maggi · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records4

Data sources9

Biological traits0

DNA specimens3

eDNA detections8

Sources9 archives

Databases and archives Aspergillus ochraceoroseus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF4 records

Environmental DNA4 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈28 Mbp

01Narrative

Aspergillus ochraceoroseus is a species of fungus in the genus Aspergillus. It is from the Ochraceorosei section. The species was first described in 1979.Bartoli, A.; Maggi, O. 1978. Four new species of Aspergillus from Ivory Coast soil. Transactions of the British Mycological Society. 71(3):383-394 It has been isolated from soil in the Tai National Forest in the Ivory Coast. It has been shown to produce aflatoxin and sterigmatocystin. In 2014, the genome of A. ochraceoroseus was sequenced as a part of the Aspergillus whole-genome sequencing project - a project dedicated to performing whole-genome sequencing of all members of the genus Aspergillus.Kjaerbolling I, Vesth TC, Frisvad JC, Nybo JL, Theobald S, Kuo A, Bowyer P, Matsuda Y, Mondo S, Lyhne EK, Kogle ME, Clum A, Lipzen A, Salamov A, Ngan CY, Daum C, Chiniquy J, Barry K, LaButti K, Haridas S, Simmons BA, Magnuson JK, Mortensen UH, Larsen TO, Grigoriev IV, Baker SE, Andersen MR Linking secondary metabolites to gene clusters through genome sequencing of six diverse Aspergillus species. Proc Natl Acad Sci U S A. 2018 Jan 23;115(4):E753-E761. doi: 10.1073/pnas.1715954115. Epub 2018 Jan 9. The genome assembly size was 27.72 Mbp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Aspergillus ochraceoroseus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Aflatoxins $ Methyl xanthones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Sterigmatocystin		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus ochraceoroseus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences6

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMH861098.1 ↗436 bpCote d'Ivoire

ACGT

CATTACCGAGTGTGAGGTCCCCCCGGGGCCCAGACCTCCCACCCGTGTCTACTTGACCCTGTTGCTTCGGCGGGCTCGCCCGCCGGAAGC …

Aspergillus ochraceoroseus strain CBS 550.77 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus ochraceoroseus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈27 718 211 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus ochraceoroseus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness92% BUSCO

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

09Environmental DNA8 detections

Where the DNA of Aspergillus ochraceoroseus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys4

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

NearcticNeotropicIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 21.3–26.8

Seasonal swing summer↔winter2.10 °C

Max temp (day)26.7 °C 26.3–27.6

Min temp (night)24.2 °C 17.6–25.8

Precipitation114 mm/mo 111–238

Air humidity63.9 % 60.4–67.3

Moisture balance-5.40 mm/mo -29.7–94.8

Vapour deficit1,038 Pa 1,000–1,241

Wind speed2.50 m/s 1.80–3.90

Cloud cover38.6 % 26.3–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)