Aspergillus neoglaber

Kozak. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources6

Biological traits0

DNA specimens0

eDNA detections26

Sources6 archives

Databases and archives Aspergillus neoglaber's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Environmental DNA4 datasets · 3 countries26 detections

DNA & barcodingNCBIsequences

01Narrative

Aspergillus neoglaber is a species of fungus in the genus Aspergillus. It is from the Fumigati section. Several fungi from this section produce heat-resistant ascospores, and the isolates from this section are frequently obtained from locations where natural fires have previously occurred. The species was first described in 1989. It has been reported to produce asperpentyn, avenaciolide, glabramycin A, B, C, sartoryglabrin A, B, C, and wortmannins.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus neoglaber has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections26

Countries6

The DNA barcodea real sequence read deposited for this species

ITSOP603843.1 ↗249 bp

ACGT

TGTCTATTGTACCTAGTTGCTTCGGCGGGCCCGCCATTCTAGAACGGCCTTCGGAGAGGCCATCGCGCCCCCGGGCCCGCGCCCGCCCAG …

Aspergillus neoglaber isolate fungal internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

09Environmental DNA26 detections

Where the DNA of Aspergillus neoglaber was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys4

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.47 4.84–8.58

Conductivity10,575 µS/cm 11.0–56,000

Organic carbon1.21 % 1.03–1.39

Phosphorus2.00 mg/kg

Clay12.5 % 12.2–12.8

Sand78.5 % 78.3–78.7

Depth0 m 0–0.2

SoilKandosolRudosolTenosolsSodosolVertosolCalcarosol

18 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.3 °C 12.9–23.2

Seasonal swing summer↔winter13.9 °C

Max temp (day)27.4 °C 16.0–29.1

Min temp (night)15.8 °C 9.20–16.9

Precipitation11.7 mm/mo 5.70–101

Air humidity45.7 % 42.9–57.1

Moisture balance-121 mm/mo -138–0.9

Vapour deficit1,376 Pa 640–1,557

Wind speed4.10 m/s 2.90–4.50

Cloud cover20.5 % 17.9–27.8

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)