Aspergillus navahoensis

M.Chr. & States · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources8

Biological traits0

DNA specimens0

eDNA detections2

Sources8 archives

Databases and archives Aspergillus navahoensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS15 compounds

Environmental DNA2 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈33 Mbp

01Narrative

Aspergillus navahoensis is a species of fungus in the genus Aspergillus. It is from the Nidulantes section. The species was first described in 1982.Christensen, M.; States, J.S. 1982. Aspergillus nidulans group: Aspergillus navahoensis, and a revised synoptic key. Mycologia. 74:226-235 It was isolated from sand in Arizona, United States. It has been reported to produce averufin, norsolorinic acid, 6,7,8-trihydroxy-3-methylisocoumarin,Yamazaki M, Satoh Y, Maebayashi Y, et al. (1988). Monoamine oxidase in- hibitors from a fungus, Emericella navahoensis. Chemical and Pharma- ceutical Bulletin 36: 670–675. desferritriacetylfusigen, echinocandin B,de la Cruz M, Martin J, Gonzales-Menedez V, et al. (2012). Chemical and physical modulation of antibiotic activity in Emericella species. Chemistry and Biodiversity 9: 1095–1113. and sterigmatocystin.Frisvad JC (1985). Secondary metabolites as an aid to Emericella classification. In: Advances in Penicillium and Aspergillus systematics (Samson RA, Pitt JI, eds), NATO ASI Series. Ser. A.: Life Sciences, Vol. 102. Plenum Press, New York: 437–443.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition15 compounds

Compounds documented for Aspergillus navahoensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Open-chain polyketides6

Anthraquinones and anthrones3

Isocoumarins1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,17R)-3,7,9-trihydroxy-17-methyl-16,21-dioxapentacyclo[15.3.1.02,15.04,13.06,11]henicosa-2(15),3,6(11),7,9,13-hexaene-5,12-dione	present	LOTUS
(1S,3As,4S,5R,7aR)-3,5,7-triethyl-1,4-dimethyl-5-[(E)-2-phenylethenyl]-3a,7a-dihydro-1H-indene-4-carboxylic acid	present	NPASS
2-[(3R,4R,6S)-4,6-diethyl-6-[(E,2R)-2-ethylhex-3-enyl]dioxan-3-yl]acetic acid	present	NPASS
6,7,8-Trihydroxy-3-methyl-1H-isochromen-1-one	present	LOTUS
Averufin	present	LOTUS
LXNOXMXZWPALFI-QQMDUOELSA-N	present	NPASS
Methyl (2z,6r,8r,9e)-3,6-epoxy-4,6,8-triethyl-2,4,9-dodecatrienoate	present	NPASS
Methyl (2z,6r,8s)-3,6-epoxy-4,6,8-triethyldodeca-2,4-dienoate	present	NPASS
methyl 2-[(3S,4S,6R)-4-ethyl-6-[(E,2R)-2-ethylhex-3-enyl]-6-methyldioxan-3-yl]acetate	present	NPASS
methyl 2-[(3S,4S,6R)-4-ethyl-6-[(E,2S)-2-ethyl-5-oxohex-3-enyl]-6-methyldioxan-3-yl]acetate	present	NPASS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus navahoensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH865257.1 ↗530 bpUSA

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGACTA …

Aspergillus navahoensis strain CBS 129251 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus navahoensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈32 758 665 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus navahoensis0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

09Environmental DNA2 detections

Where the DNA of Aspergillus navahoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)