Aspergillus montevidensis

Talice & J.A.Mackinnon · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records9

Data sources8

Biological traits0

DNA specimens1

eDNA detections8

Sources8 archives

Databases and archives Aspergillus montevidensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF9 records

Environmental DNA3 datasets · 5 countries8 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈27 Mbp

01Narrative

Aspergillus montevidensis is a species of fungus in the genus Aspergillus. It is from the Aspergillus section. The species was first described in 1931.Talice, A.V. & Mackinnon, J.A. 1931, C.R. Séanc. Soc. Biol. Argentina 108: 1007 It has been reported to produce apolar indoloterpenes, asperflavin in few isolates, auroglaucin, dihydroauroglaucin, echinulins, epiheveadrides, flavoglaucin, isoechinulins, neoechinulins, and tetrahydroauroglaucin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus montevidensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections8

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPX875887.1 ↗214 bpPoland · 2023

ACGT

GAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCC …

Aspergillus montevidensis isolate iso349 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus montevidensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈26 622 312 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus montevidensis0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type9 records

Museum / vouchered6

Cultivated / captive3

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Aspergillus montevidensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys3

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map5 countries0

PalearcticAfrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C -1.10–20.8

Seasonal swing summer↔winter20.0 °C

Max temp (day)14.2 °C 3.80–25.9

Min temp (night)6.70 °C -7.00–15.8

Precipitation76.3 mm/mo 52.9–110

Air humidity59.1 % 57.0–63.4

Moisture balance2.80 mm/mo -46.9–25.4

Vapour deficit562 Pa 303–1,039

Wind speed3.70 m/s 1.10–4.90

Cloud cover35.9 % 23.8–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)