Aspergillus microcysticus

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources9

Biological traits0

DNA specimens1

eDNA detections3

Sources9 archives

Databases and archives Aspergillus microcysticus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS106 compounds

Environmental DNA3 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aspergillus microcysticus is a species of fungus in the genus Aspergillus. Aspergillus microcysticus produces aspochalasin A, aspochalasin C, aspochalasin D, and the antibiotic asposterol.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition106 compounds

Compounds documented for Aspergillus microcysticus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aporphine alkaloids $ Isoquinoline alkaloids19

Kaurane and Phyllocladane diterpenoids10

Simple phenolic acids8

Cinnamic acid amides8

Cyclic peptides6

Documented compounds106 total

Compound	Amount	Source
(+)-Episyringaresinol	present	NPASS
(+)-Syringaresinol	present	NPASS
(-)-Corydalmine	present	NPASS
(-)-Kaur-16-en-19-oic acid	present	NPASS
(-)-Nornuciferine	present	NPASS
(1S)-1-[(4-hydroxy-3-methoxyphenyl)methyl]-6-methoxy-2-methyl-3,4-dihydro-1H-isoquinolin-7-ol	present	NPASS
(1S,4R,9R,10R,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyl-tetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	NPASS
(1S,4R,9R,10R,13R,14S)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	NPASS
(1S,4S,5R,9S,10R,13R,14R)-14-(acetyloxymethyl)-5,9-dimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1S,4S,5R,9S,10R,13R,14R)-14-(dimethoxymethyl)-5,9-dimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus microcysticus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPZ169418.1 ↗544 bpChina · 2022

ACGT

CCTGCGGAAGGATCATTACCGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAG …

Aspergillus microcysticus isolate Z6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

09Environmental DNA3 detections

Where the DNA of Aspergillus microcysticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.