Aspergillus leporis

States & M.Chr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records23

Data sources10

Biological traits0

DNA specimens5

eDNA detections9

Sources10 archives

Databases and archives Aspergillus leporis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF23 records

Environmental DNA4 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT · NCBI≈39 Mbp

01Narrative

Aspergillus leporis is an anamorph species of fungus in the genus Aspergillus. It is from the Flavi section. The species was first described in 1979.Bartoli, A.; Maggi, O. 1978. Four new species of Aspergillus from Ivory Coast soil. Transactions of the British Mycological Society. 71(3):383-394 It has been isolated from the dung of Lepus townsendii. Aspergillus leporis produces leporin A and leporin B. It has also been reported to produce antibiotic Y, kojic acid, and pseurotin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition3 compounds

Compounds documented for Aspergillus leporis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Miscellaneous meroterpenoids2

Pyridine alkaloids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4R,4aS,5S,7R,7aS,8S,9R,11aS)-8-(1H-indol-3-yl)-4,4a,7-trimethyl-9-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,8,9,10,11-dodecahydrobenzo[d]naphthalene-1,5-diol	present	LOTUS
10,23-Dihydro-24,25-dehydroaflavinine	present	LOTUS
Leporin A	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus leporis has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV522067.1 ↗534 bpEgypt · 2017

ACGT

CTAGGGGCCCAACCTCCCACCCGTGTTTATTACTACCTTGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCATCAGCTCCCTGG …

Aspergillus leporis strain DA-SN3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus leporis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈39 425 861 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus leporis0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.4% BUSCO

08Occurrence & distribution

Record type23 records

Museum / vouchered23

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence23

10Collections & institutions

Institution	Specimens
UAclocation not on record	1

1 institutions · 1 of 23 vouchered records shown · 21 without an institution code

09Environmental DNA9 detections

Where the DNA of Aspergillus leporis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys4

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 12.3–19.6

Seasonal swing summer↔winter19.5 °C

Max temp (day)26.2 °C 16.2–26.2

Min temp (night)13.4 °C 7.20–13.4

Precipitation76.3 mm/mo 76.3–237

Air humidity51.6 % 51.6–59.6

Moisture balance-63.0 mm/mo -63.0–132

Vapour deficit1,106 Pa 699–1,106

Wind speed1.80 m/s 1.80–2.50

Cloud cover21.0 % 21.0–35.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)