Aspergillus kanagawaensis

Nehira · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records24

Data sources8

Biological traits0

DNA specimens8

eDNA detections25

Sources8 archives

Databases and archives Aspergillus kanagawaensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF24 records

Environmental DNA3 datasets · 14 countries25 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Aspergillus kanagawaensis is a species of fungus in the genus Aspergillus. It is from the Cervini section. The species was first described in 1951.Nehira 1951, J. Jap. Bot. 26: 109 It has been reported to a few extrolites, including two polar indol-alkaloids and one polar indol-alkaloid.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus kanagawaensis has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes1

GenBank sequences9

eDNA detections25

Countries14

The DNA barcodea real sequence read deposited for this species

ITSFJ491626.1 ↗399 bp

ACGT

GGCGGGCCCGCCGTCAGGCCGCCGGGGGGCATTCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACACGAACACTGTTCTGAATTGCAG …

Aspergillus kanagawaensis strain CBS 424.68 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type24 records

Museum / vouchered21

Cultivated / captive3

Range

Area of Occupancy AOO84 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence21

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Madison, US	2
DPIlocation not on record	2

2 institutions · 4 of 21 vouchered records shown · 17 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA25 detections

Where the DNA of Aspergillus kanagawaensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys3

Countries14

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map14 countries0

AfrotropicNeotropicAustralasiaNearcticIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 12.2–25.8

Seasonal swing summer↔winter4.60 °C

Max temp (day)25.5 °C 15.0–29.0

Min temp (night)19.4 °C 8.90–22.7

Precipitation166 mm/mo 96.3–357

Air humidity63.3 % 58.7–68.1

Moisture balance30.1 mm/mo -18.1–228

Vapour deficit946 Pa 517–1,083

Wind speed2.40 m/s 1.10–5.60

Cloud cover41.5 % 26.1–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)