Aspergillus insulicola

Montem. & A.R.Santiago · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources8

Biological traits0

DNA specimens2

eDNA detections5

Sources8 archives

Databases and archives Aspergillus insulicola's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS13 compounds

Environmental DNA4 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Aspergillus insulicola is a species of fungus in the genus Aspergillus. It is from the Circumdati section. The species was first described in 1975.de Montemayor, L.; Santiago, A.R. 1975. Mycopathologia. 55(2):125-137 It has been reported to produce xanthomegnin, viomellein, vioxanthin, and penicillic acid.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition13 compounds

Compounds documented for Aspergillus insulicola across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclic peptides5

Linear polyenes2

Stigmastane steroids1

Drimane sesquiterpenoids1

Dipeptides1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Azonazine	present	LOTUS
6-((1E,3E,5E)-6-((2R,3R,3aR,4R,5R,6aS)-5-Ethylhexahydro-3,4-dihydroxy-3a,4-dimethylfuro(2,3-b)furan-2-yl)-1,3,5-hexatrien-1-yl)-4-methoxy-5-methyl-2H-pyran-2-one	present	LOTUS
6-[(1E,3E,5E)-6-[(2R,3S,3aR,4R,5R,6aS)-2-ethyl-3,4-dihydroxy-3,3a-dimethyl-2,4,5,6a-tetrahydrofuro[2,3-b]furan-5-yl]hexa-1,3,5-trienyl]-4-methoxy-5-methylpyran-2-one	present	LOTUS
Aspochracin	present	LOTUS
beta-Sitosterol	present	NPASS
Insulicolide A	present	LOTUS
Jbir-15	present	LOTUS
N-[(3S,6S,9S)-3,7-dimethyl-2,5,8-trioxo-6-propan-2-yl-1,4,7-triazacyclododec-9-yl]-6-oxohexa-2,4-dienamide	present	LOTUS
Pre-sclerotiotide F	present	LOTUS
Pseurotin A	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus insulicola has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences9

eDNA detections5

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMH860926.1 ↗384 bpVenezuela

ACGT

CTGAGTGAGGGTTCCTTCGGGGCCCAACCTCCCACCCTTGTATACCGTACCAAGTTGCTTCGGCGGGCCCGCCGTTCGCGCGGCCGCCGG …

Aspergillus insulicola strain CBS 382.75 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

09Environmental DNA5 detections

Where the DNA of Aspergillus insulicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys4

Countries1

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.24

Conductivity34,300 µS/cm

Depth0 m

SoilKandosol

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 21.5–21.5

Seasonal swing summer↔winter8.90 °C

Max temp (day)28.4 °C

Min temp (night)15.7 °C

Precipitation3.80 mm/mo

Air humidity51.4 %

Moisture balance-111 mm/mo

Vapour deficit1,243 Pa

Wind speed3.20 m/s

Cloud cover30.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)