Aspergillus halophilicus — The Life Data

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Trichocomaceae/Aspergillus

At a glance

Occurrence records3

Data sources6

Biological traits0

DNA specimens0

eDNA detections1

Sources6 archives

Databases and archives Aspergillus halophilicus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Aspergillus halophilicus is a species of fungus in the genus Aspergillus. It is from the Restricti section. The species was first described in 1959.Christensen, C.M.; Papavizas, G.C.; Benjamin, C.R. 1959. A new halophilic species of Eurotium. Mycologia. 51(5):636-640 It has been isolated from dried corn in the United States and a textile in the Netherlands. It has been reported to produce chaetoviridin A, deoxybrevianamid E, pseurotin A, pseurotin D, rugulusovin, stachybotryamide, and tryprostatin B.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus halophilicus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKY588996.1 ↗226 bp

ACGT

TTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCGCCGTCCCGGGGGACTTTTCTCCCCCGCGGGACGGGCCCGAAAGGCAGCGGCGGCA …

Aspergillus halophilicus clone G-jav1-ITS2_OTU-0-185_5 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type3 records

Museum / vouchered3

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

09Environmental DNA1 detections

Where the DNA of Aspergillus halophilicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Verifiable raw sequence linked1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.