Aspergillus granulosus

Raper & Thom · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records7

Data sources10

Biological traits0

DNA specimens3

eDNA detections94

Sources10 archives

Databases and archives Aspergillus granulosus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI94 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 records

Environmental DNA6 datasets · 9 countries94 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Aspergillus granulosus is a species of fungus in the genus Aspergillus. It is from the Usti section. The species was first described in 1944.Raper, K.B.; Thom, C. 1944. New aspergilli from soil. Mycologia. 36(6):555-575 It has been reported to produce asperugins, ustic acids, nidulol, and drimans.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus granulosus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

eDNA detections94

Countries9

The DNA barcodea real sequence read deposited for this species

ITSPX446506.1 ↗451 bpThailand · 2019

ACGT

GGGGCAGCCGCCGGAGACCACACCGAACCTCTTGTTTAAGCCTGTTGTCTGAGCTTGATAGCAAATCTATTAAAACTTTCAACAATGGAT …

Aspergillus granulosus isolate HN42084753-FC55614 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus granulosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈35 311 868 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus granulosus0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type7 records

Museum / vouchered7

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	1

1 institutions · 1 of 7 vouchered records shown · 6 without an institution code

09Environmental DNA94 detections

Where the DNA of Aspergillus granulosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found94

Studies independent surveys6

Countries9

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 94 detections have coordinates

Open the map9 countries0

NeotropicPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature9.00 °C

pH6.74 4.20–9.10

Conductivity10,980 µS/cm 12.0–160,000

Organic carbon0.98 % 0.24–5.51

Water content10.0 % 2.13–27.2

Nitrate-N2.00 mg/kg 1.00–5.00

Phosphorus10.0 mg/kg 3.00–91.0

Clay12.6 % 5.97–58.8

Sand82.6 % 28.8–98.0

Depth0 m 0–0.2

SoilChromosolVertosolTenosolCalcarosolPodosolTenosols

42 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 16.1–27.2

Seasonal swing summer↔winter11.0 °C

Max temp (day)27.8 °C 21.3–29.8

Min temp (night)17.7 °C 11.1–26.2

Precipitation19.1 mm/mo 6.20–121

Air humidity53.6 % 44.8–64.8

Moisture balance-110 mm/mo -139–145

Vapour deficit1,314 Pa 810–1,579

Wind speed4.10 m/s 2.00–6.60

Cloud cover23.3 % 15.4–31.2

CHELSA 1981–2010, ~9 km grid, at location & month of 89 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)