Aspergillus glaucus

(L.) Link · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records85

Data sources8

Biological traits0

DNA specimens11

eDNA detections15

Sources8 archives

Databases and archives Aspergillus glaucus's data was compiled from.

GBIFGlobal Biodiversity Information Facility85 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionNPASS14 compounds

Occurrence & distributionGBIF85 records

Environmental DNA5 datasets · 2 countries15 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceNCBI28 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition14 compounds

Compounds documented for Aspergillus glaucus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Tetracyclic diterpenoids $ Tigliane diterpenoids5

Monocyclic monoterpenoids1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(S)-alpha-Phellandrene	present	NPASS
[(1R,2R,6R,10S,11R,13S,15R)-1,6-dihydroxy-8-(hydroxymethyl)-4,12,12,15-tetramethyl-5-oxo-13-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] (E)-2-methylbut-2-enoate	present	NPASS
[(1R,2R,6R,10S,11R,13S,15R)-8-(acetyloxymethyl)-1,6-dihydroxy-4,12,12,15-tetramethyl-5-oxo-13-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] (E)-2-methylbut-2-enoate	present	NPASS
[(1R,2R,6R,10S,11R,13S,15R)-8-(acetyloxymethyl)-1,6-dihydroxy-4,12,12,15-tetramethyl-5-oxo-13-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] 2,2-dimethylpropanoate	present	NPASS
[(1R,2R,6R,10S,11R,13S,15R)-8-(acetyloxymethyl)-1,6-dihydroxy-4,12,12,15-tetramethyl-5-oxo-13-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] 2-methylpropanoate	present	NPASS
[(1R,2S,6R,10S,11R,13S,15R)-8-(acetyloxymethyl)-1,6-dihydroxy-4,12,12,15-tetramethyl-5-oxo-13-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] (2R)-2-methylbutanoate	present	NPASS
Aspergiolide B	present	NPASS
AVYRWRRYPRHDJL-AZFSHXRASA-N	present	NPASS
BFHKLXFIZWDGDV-SNVBAGLBSA-N	present	NPASS
GNCCYEWRQRSSCY-ZYEMBSKXSA-N	present	NPASS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus glaucus has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes1

GenBank sequences10

eDNA detections15

Countries8

The DNA barcodea real sequence read deposited for this species

ITSMH855094.1 ↗476 bpFrance

ACGT

ATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGAAG …

Aspergillus glaucus strain CBS 114.30 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceNCBI

The complete instruction manual Aspergillus glaucus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size27 990 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus glaucus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type85 records

Wild obs. + sensor17

Museum / vouchered68

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 3≤10 km 14

17 georeferenced

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 1≤10 km 25>10 km 8

34 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	10
Bernard Price Institute for Palaeontological Researchlocation not on record	9
Museo Entomologico de Leonlocation not on record	6
Lincoln, US	4
PHlocation not on record	4
Champaign, US	3
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	3
Karlsruhe, DE	3
DPIlocation not on record	3
Catholic University of Pekinglocation not on record	2
Chapel Hill, US	1
Cincinnati, US	1
Chicago, US	1
UAclocation not on record	1
Toronto, CA	1
Auckland, NZ	1
LDlocation not on record	1
Madison, US	1

18 institutions · 55 of 68 vouchered records shown · 13 without an institution code

09Environmental DNA15 detections

Where the DNA of Aspergillus glaucus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys5

Countries2

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

marine sediments

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C -9.30–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C -6.50–30.5

Min temp (night)19.3 °C -13.1–19.3

Precipitation109 mm/mo 37.8–109

Air humidity52.0 % 47.3–52.0

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa 528–1,616

Wind speed1.80 m/s

Cloud cover25.2 % 25.2–30.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)