Aspergillus giganteus

Wehmer · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records4

Data sources11

Biological traits0

DNA specimens15

eDNA detections17

Sources11 archives

Databases and archives Aspergillus giganteus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS35 compounds

Occurrence & distributionGBIF4 records

Environmental DNA3 datasets · 0 countries17 detections

DNA & barcodingBOLD · NCBI15 specimens

01Narrative

Aspergillus giganteus is a species of fungus in the genus Aspergillus (from Latin "aspergillum," meaning "holy water sprinkler") that grows as a mold. It was first described in 1901 by Wehmer,Wehmer 1901, Mem. Soc. Phys. Genève 33(2): 85 and is one of six Aspergillus species from the Clavati section of the subgenus Fumigati. Its closest taxonomic relatives are Aspergillus rhizopodus (Rai et al., 1975) and Aspergillus longivescia (Huang and Raper, 1971).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition35 compounds

Compounds documented for Aspergillus giganteus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols7

Flavones5

Miscellaneous polyketides3

Carotenoids (C40, Ψ-Ψ)2

Cinnamic acids and derivatives1

Documented compounds35 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-3-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid	present	NPASS
(2S,3R,4R,5S,6R)-2-(hydroxymethyl)-6-(4-hydroxyphenoxy)tetrahydro-2H-pyran-3,4,5-triol	present	NPASS
(4~{S})-4-oxidanyl-4,6-dihydrofuro[3,2-c]pyran-2-one	present	LOTUS
1-Methylthioguanine	present	LOTUS
2-(2-Hydroxyethylidene)-5-oxofuran-3-carbaldehyde	present	LOTUS
2-[(R)-cyano-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]prop-2-enyl 4-hydroxybenzoate	present	NPASS
3-[(2R,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-5,7-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one	present	NPASS
4-Vinylphenol	present	NPASS
5,6-dihydroxy-2-(4-hydroxyphenyl)-7-[(2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one	present	NPASS
5,7-Dihydroxy-2-(4-Hydroxyphenyl)-3-((2R,3S,4R,5R,6S)-3,4,5-Trihydroxy-6-(Hydroxymethyl)Oxan-2-Yl)Oxychromen-4-One	present	NPASS

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus giganteus has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes2

GenBank sequences10

eDNA detections17

Countries9

The DNA barcodea real sequence read deposited for this species

ITSMH857533.1 ↗445 bpNetherlands

ACGT

GGCGGGCCCGCCGTCTTCGGACGGCCGCCGGGGAGGCCTCCGCGCCCCCGGGCCCGCGCCCGCCGAAGACCACAACATGAACTCTGTTCT …

Aspergillus giganteus strain CBS 117.56 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

08Occurrence & distribution

Record type4 records

Wild obs. + sensor2

Museum / vouchered2

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA17 detections

Where the DNA of Aspergillus giganteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)