Aspergillus funiculosus

G.Sm. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records2

Data sources9

Biological traits0

DNA specimens1

eDNA detections5

Sources9 archives

Databases and archives Aspergillus funiculosus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF2 records

Environmental DNA4 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈26 Mbp

01Narrative

Aspergillus funiculosus is an anamorph species of fungus in the genus Aspergillus. Aspergillus funiculosus produces the funiculolides A-D and the antibiotic funicin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition5 compounds

Compounds documented for Aspergillus funiculosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Tetraketide meroterpenoids2

Fungal DPEs $ Simple phenolic acids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
4-Carbethoxydiorcinal	present	LOTUS
Funiculolide A	present	LOTUS
Funiculolide B	present	LOTUS
Funiculolide C	present	LOTUS
Funiculolide D	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus funiculosus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences5

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH857532.1 ↗501 bpNigeria

ACGT

CCTCCCACCCTTGTGTATTAGACCCTGTTGCTTCGGCGGGCATCCCCCCTATATTCTAGGGAGGTAGTCCCCGCCGGTAGCCCTATACAT …

Aspergillus funiculosus strain CBS 116.56 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus funiculosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈25 696 535 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus funiculosus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

09Environmental DNA5 detections

Where the DNA of Aspergillus funiculosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys4

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 24.9–25.9

Seasonal swing summer↔winter2.90 °C

Max temp (day)27.4 °C 26.8–27.9

Min temp (night)23.6 °C 22.2–25.0

Precipitation122 mm/mo 108–136

Air humidity62.9 % 62.0–63.9

Vapour deficit1,202 Pa 1,135–1,270

Cloud cover27.3 % 27.2–27.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)