Aspergillus fumisynnematus

Y.Horie, Miyaji, Nishim., Taguchi & Udagawa · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records7

Data sources10

Biological traits0

DNA specimens2

eDNA detections10

Sources10 archives

Databases and archives Aspergillus fumisynnematus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS85 compounds

Occurrence & distributionGBIF7 records

Environmental DNA3 datasets · 4 countries10 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Aspergillus fumisynnematus is a species of fungus in the genus Aspergillus. It is from the Fumigati section. The species was first described in 1993.Horie, Y.; Miyaji, M.; Nishimura, K.; Taguchi, H.; Udagawa, S.I. 1993. Aspergillus fumisynnematus, a new species from Venezuelan soil. Transactions of the Mycological Society of Japan. 34(1):3-7 It has been reported to produce neosartorin, pyripyropens, and fumimycin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition85 compounds

Compounds documented for Aspergillus fumisynnematus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chalcones9

Flavonols8

Wax monoesters7

Aurones6

Cinnamic acids and derivatives6

Documented compounds85 total

Tissue Source Quantified only

Compound	Amount	Source
(2e)-7-Phenylhepta-2-en-4,6-diyn-1-yl acetate	present	NPASS
(2R)-7-phenylhepta-4,6-diyne-1,2-diol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(2R)-1-hydroxytrideca-5,7,9,11-tetrayn-2-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,2R)-1-hydroxytridec-5-en-7,9,11-triyn-2-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,3R)-1-hydroxytetradec-6-en-8,10,12-triyn-3-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,3S)-3-hydroxytetradec-6-en-8,10,12-triynoxy]oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[5-(2-phenylethynyl)thiophen-2-yl]methoxy]oxane-3,4,5-triol	present	NPASS
(2S)-7-phenylhepta-4,6-diyn-2-ol	present	NPASS
(2S,8E,10S,11S)-trideca-8,12-dien-4,6-diyne-2,10,11-triol	present	NPASS
(2Z)-2-[(3,4-dihydroxyphenyl)methylidene]-6-hydroxy-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1-benzofuran-3-one	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus fumisynnematus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections10

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPX740646.1 ↗505 bpChina · 2022

ACGT

CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGG …

Aspergillus fumisynnematus strain S2FRS54 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type7 records

Museum / vouchered7

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

09Environmental DNA10 detections

Where the DNA of Aspergillus fumisynnematus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys3

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map4 countries0

AfrotropicNeotropicPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 17.2–26.7

Seasonal swing summer↔winter4.90 °C

Max temp (day)25.1 °C 19.1–31.4

Min temp (night)18.3 °C 14.3–22.1

Precipitation139 mm/mo 44.8–258

Air humidity59.9 % 56.2–63.1

Moisture balance-2.50 mm/mo

Vapour deficit1,030 Pa 808–1,434

Wind speed3.40 m/s

Cloud cover30.4 % 26.2–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)